Description :
From Genome Similarity Track
Location :
Scaffold_691:14- 3898
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_691-snap-gene-0.5Poly [ADP-ribose] polymerase 2
Pytve_DAOMBR484maker-pve_contig_691-fgenesh-gene-0.3CAAX prenyl protease 1

Sequence
3884 bases(100 bases per row)
ACATGCAGCCGGACCCGTACCTCCCGGATGACTTTCGGCGGCGCGCGCGCGTGTTCCGCCGCCACGAGACGGTGTTCGACGCGTTGCTGACCCGCGTACG
TGACTCGTAGGTCTGCGAGGAGGGAGGAGTGAATGCGCTGGCTTGCTAACTCACAGAGTGATGATAATGGCGGTGGTGTCCACGTCGTACGGTGCGGACG
GACGTGCAGGCCCGCGTGCACCACAACCAGAGCGAGTTCATCGCGCTGCAGGCGCTCGAGCTGGACGACAAGACGTTCTACCTGTGGACGCGCGCAGGCC
GCGTCGGGTGCGCCGGCAAGTCGGCGCTGAGCGGGCCGTACGCGCAGGAGACGACGGTCGTGAACGAGTTCTGCGCGCTCTTCGCGTCCAACACGCTGTG
CGAGTGGGACGAGCGCCACCACCACGGCCGCCGCTACCAGGAGGGCAGGTACCGTGCAATGCTCACTATGCTGTACTCTGCATTATTAGCCTCACCATTG
ATGCCTGACGCGAGTGCATGCATGCTGCTCGTCTATGGCTAGCTACACGTGGATCGAGCTCGACTACTCGACGGGCACGCCGTACTCCGAGTCGCTCACG
TCGGCGCTGGCCGACAACCAGGGCCAGCTCGACCGCATCGAGAGCAACCTGGACGAGTACGGGCTCCTAGTGCCGCCGGCGCCGCTCCCGGTCTCGCTCA
TGTCCCCTGGGGCCACGCTGCCGCTGCTCTCGACCATCACGGGACGCAAGCGGCGACGCACGGCGTCAACCAGCACGCGGCGGTCGCTGGCCGCGCAGTT
CGAGCTGTTTGAACAGAGCGACGTCAAGACCACGGGACGAACGCGGGTCGCGACCGCGGCCACCGAGGTAGAGCTGAAGCACCCGCCGCCGTCGACGCTG
CCCGAGGCCGTGCAGACCTTCGTGACACTGATCGCGGACCACGCGGACGCGGCCTACGCCTACTCGGCCGTCCTGCCGGACGACTCGCTGGACGACGGCG
TACTGCAGATGCCGCTCGGGCGGCTCTCCAAGTCGACGGTGCTGCGGGTAGAGCGCAGCGCTTTGAGATGTCCTGATCTTTGCTCGTTGGCCATGCTAAC
GATGAAATGTGGCAGGGGTACGAGACGCTCGAGGAGCTGTACGACGCGCTGAGCAACCGACAGGCGTCCCGCGAGCGGCTCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTTCTACGCGCTCGTGCCGCACCACGCGAGGCTGGAGGTGATCGACTCGATGGTCAAGCTCGGCCGCAAGGTCGCGCTGCTCGAGGAGCTC
AGCCGCGGCCTCCACGCGGAGGACGTCGTTCGGCGCTGCCGCGCGCGCAACTACGTGGACGAGTGCTACGCGCTGCTGGACTGCGGGCTGTTCCCGCTGG
AGCGCGACTCTGCCGAGTTTGCGCGCATCGAGACGTACGTGAAGAACTCGAACTGCTGCGGCAGGAAGCAGGACCGGCTCGAGCTGCTCGGCGTGTTNNN
NNNNNNNNNNNNNNNNNNGAGGTGCACAAGCCCGAGCTGGAGCGCCGTTACGAGCCGTTCCGCAGGTTCCCGAACCGCAGGGTACGGACACGGGGGCTGC
TCGCGCTCGCTCGACGAGACTGTGCTCTCATGGAGTGTGCTGTCTGTTGTAGATGCTGTGGCACGGCAGCCACGTGTCCAACTGGATGGGCATCCTGACC
GATGGACTGCGCATCGCGCCGCCGGACGTGGCGTCGAACGGCCGCACGTTCGGCAAGGGGCTATACTTCACGGACAAGGTGTCGAAGGCCCAAGCGTACT
GCCATTGCCGGCCGGCTGCGAGCGGCGGTGCGAGTCAGTGTGTCTTTTTGCTCAACGAGGTGGCGCTCGGCGAGAGCAAGGAGATGGTCAACTCGGACGA
CAACGCGCGGCAGTATGTGCACGCCACGGCCGGCGGTCGCACGAAGCAGGGCCAGTTTCAGAGCTGCAAGGGGGTCGGGTCGTGCTGTCCGGACCCGCGA
GGCGACGTGCTGGACGACCATGGCGCCGTTTGGCCGCTCGGGAAACCCGTGCAGCCGAAGGACCGCACGGGTCTGCACCACAGCGAGTACATTATCTACA
ACCCGCACCAGACGCGCATGCGCTACGTCGTGCTCGCGCGCAGCGCCTACTAGAGCGCGTCAGGGCGGACGGACCGGCGAGACCTGTCGCCGAGGGATGA
TGAGTGATGAACTGTAAGTGGCAGTGCGTGTAGTGTTTGTTTTTCATTCGTGTGATTGGATGCGCTTGTAGAATGATAGGCTTCGTATTGACTCCTCCAC
TCGATCCTCCATCACCTTCTTCTTCTTCTCCTTCTTCTTGCTCTACTCGATCTACTCGCTCTTCTTGGCGCGCGCCGTGATGGCGTTGAGGCGCTCGACG
AGCGGCGGGTGGCTGTAGTGGTAGGCGCTGTAGAGCGGGTCCGGGTTCATGTTGCTCAGGTTCTCGATCGCGAGCTTGGTGAGTCCCGTCTTGAGCGGCG
CCGCGAGGTCGAGGTCGACCGCGAACGCGTCGGCGGCGAACTCGTTGCGACGCGTGTTGAGCGTCAAGAGGAACGAGAGCACGTGGTCCACGGGAGCCCA
GACGGTCTGCGAGAAGAGCAGGAGGCCGATGAGCACTGGCTTGGGGCCATCCGCGGCAAAGCCGAAGCTCGCAAACAGCTCCGAGTCGTTCATGCAGCGA
CCGAACACGAAGAAGAGCGCGAGCGTGTAGAGTTGCTGGATGACGAAGCCCTGCGCCGTGTGCCACAGCTGCCAGTGGCCGAGTTCGTGGCCGAGCACTG
CGACGATCTCGTCGTCCGTCGCCTGCTCGAGCAGCGTGTCGTACAGCACGATGCGCTTCGACTTGAAAAAGCCGAAGAAGTACGCGTTGCTGTGGCTCGA
GCGCTTGGAGCCGTCGCACACGAACAGCTTGGTGAGCGGGAAGTGCAGGCGAGCGGCGAGCGCCTCGATGCGAGTGCGGAGCTCGCCGGCCTCGAGCGGC
GTGAACTTGTTGAAGAGCGGCATGATGAGCACTGGGTAGAGCGTCACCATGATGAGCGAGAAGGCCAGCAGCAGCACCCACACATACAGGTAGAAGAGCT
CGCCTCCCCACCGCACGACCACGATGAGCGCGGCAATGAGCGGGTAGCCGATGGCGACGAACAGCGCGAGACCCTTGATCTTATCGAGGAAAAAGAGTCC
GAGCGTCTGCTTGTTGAAGCCGTGGCGCGCCTCGATCACGAACGTCGAGTAGAGCGAGAACGGCAGACCCACTAGTGTGTCGCGAATCGTCGTGAGCGTG
AGCAGCATGAGCGCGCGCGAGATCTCGTTGGTCGCGTCCAGGCCGAGCAGCGCCAGCGTCTGGCCGCTCAGCGTCCACATGAACGGGAGGTAGCCCACCA
GCAGCAGCGCTGTGGCCTCCACCTGGTTGTAGGCGCCTTGCAGCAGTCCGAACGAGCTCTTGTCGAGGCCGTAGGCACGACTCTGGTCGAACTTGGCGCG
CGTGGCATCGAGCAGCGACACGTGCTCGGCATCGGTCTTGTCCTTGGGTTCGTCCTTCTTCACATCCTCGTCCTTCTTCTCATCCTTGTCCTCCTCTTCC
TTCTTCTCGTCCTTCGCCTTCGGCTTGTAGCTGCCGAGGTTGCGCAGCGCCTCCTCCAGCGGCGGTGGGAACGCCGTGTCCTTGAGCTTGCGGTGTTGGC
TGCGACACCGCCAAGCATTGTTAGATACCGAGAGCAACAATCATCAACGACCGCAACTCGCACCGGAGGTCGAGGTAGGTCTCGAATACGTAGACGAGCG
TGAGGAACGCAAGACAGGCCGCAAAGTACGGGACAGCGGGGGCTCGCCAGCCGTCCTCGCGGTAGTACGGCGCCTGCCACCACG