Description :
From Genome Similarity Track
Location :
Scaffold_170:14- 3797
Sequence
3783 bases(100 bases per row)
TCGGGAGTCGCCTCGTACGCCAGTTTCGGCGATTCTCTGTAGCGACGGGATCCCACTGACACATATCCAGGTCGCCTTGGGATACCGTCCTTCGCTAACC
ATCGCCCGATCTCCTCATAATGGTCCAGTCATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACGGTAGG
CACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACACTAACCGATCTGGCAGTTCCCATGTTTCTCCGGGCTCGATCCAGGTCGTC
GTATCCGCCCTTATGATCCTCATCTTTGCCCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCACATCTCGTCGGGGAAACACAGTGTCCCATTCGCCA
GATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGAACCGGTATACCAAACA
ACCTGCCAGCGTGACCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATTTCAACACAATCTAGGATCCGACTCCCATCCACTTGGCAC
CCAACCTTACGAGCAAAGGCGGTGTCTTGTATAGACACCTCGACACCACTATCTAGGAGTAGGATTGCTTTTTCGTTGTTGATCTTGCCCCCTACCTTGG
CTTGCCTGAACCATTTTCCTGGGGCATAGTACTTCCAGTATCCACGGGACTCCCCTGTCAGTAGATCCATGGATTCAACATCTTCTGATCCCCGGGATCC
AGTAACCTGACAAACCTTGGGTGGATCTGCAGTAACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTTTCCCAATAACCACGTGCCTCT
CCCCCTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATCCCCTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATTTAGATGAC
TTGTATTATCGACTGGATCTAGGAGCCTGCTACCTGGATCTAGTGATGACTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGG
ATTTAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGT
AGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCACGACACACGTAGAAGCAATGATCTCCAGGATGACCTTTCTTGCCACACTT
CTCACAACCAGATGTTTCCAACATCCACCTTCTGTGTGCTTCCGGGATCCACACTGCGAGCACCTGATTTGCCTGATATCTCGGGATCTGTACATCCCAC
GGTCCCCGGGTACGGTACCCCCTGATCAAGAGTTGTCTCCGTTCTTCGCCGTACGATCGTTGGGTGCAGTGAGGCAGACTCGGCGGTAATCCTCTGGGTC
GGAGTCCGAACCATCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGA
TACTTGACGGATCCTACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGTTCCACAGTTCGCAGCACTTCTTCCAGCTCATCTGCGTCTGGAAGACGTAATA
GGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTATAACTT
GGCCCGTAGACCGGCCACATTTAGTCGATGCAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTGTTGTCGTGCCACCGACACTCTT
AATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACGTGTTCCTGGTGGATCTGCCCAGCCGCCGATACCAATTCCTGGCTGGCCCCGCTA
GCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCACTCATGAGAGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATC
TTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATAGACGATCCACCAGCCCCGGCTGCGGCTGTTGCTACC
ACCGCCGACGAAGGGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTTTCTTCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCAT
GTTCATGGAACACTTGCGCTTGCGGCTTGGGCTTGTTTGACCAAGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGAAGGTGTCGG
AAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGATTCGTGAGGAGATTACCTTGAGCCCGATCGGACGATAACCCCACTGGCTTCTTGCCGGATCT
GGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCGAGTCTTCACGCTCAAAGGGACTTCCTGTCCCCAGATCCTCGCCCGC
GCTTTCCAGCATGGATGCCCCGGAGGGTCCTAACGGCATGCGTCGGGGCTCGGACGACGTGTCGGACCCATCCTCAGCCGCGGATTCGTAGTTCGAGGAC
GCAGCTTGGCTGGTCCTCGGCGACGACACTGGATCCCTAGTGCGCGACCTTTCTCCGGTGATGGACTTAGCTCTGACAAAGAGGTCCCGTGTTGCGGATA
CTATGAGATCCAAGTCTAGCTCGACGATATCCTCTGCGTCGAACACACCAGCTACGATCCCCGACTCCGTAAGTAAACGTAATAGATCTTTGACTGCCAC
CAACTTGTTCGCCGTTTTAGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGAATTCAAATTCCGCATGACAGGATTTTGATGCAGCAAA
TCGCGTAGAGCTTGGTGGCGATCCACAAACTCGAGATCCTTGTCGGACCAGCTGGACCTGGATCCATCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCT
TCTTCTGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTAGACTAGCGGGCTTGGGTTTGGGTACGATGTTGGCTTAACCGGTGAATCTGCAAA
TGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGAGCTGGGGAGGATAGAGA
GGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTTCGTTGACCGAGTTCCTCCCAAAACGCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCG
TCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTTACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGACTCACCAAACGA
TCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCAGCGAGATTGCCAGATCCAACTTACCAACAGCGCCCAGACACCGACTAACGGAGGG
GTCCCCCAATGATCCGTGATCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGATAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTG
GTGAATCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAAGCAGCAGTGGTAATATCTTCACTCTGCGTCCGTGGTTGGT