Description :
From Genome Similarity Track
Location :
Scaffold_922:14- 3489
Transcript NameFunction/comments
Phyke_g11285hypothetical protein PHYSODRAFT_321620
Phyke_g11286hypothetical protein PHYSODRAFT_321620
Phyke_g11287hypothetical protein PHYSODRAFT_343161

Sequence
3475 bases(100 bases per row)
GATGTAGACGACTTGAGACTGAAGtaaattgcagaatgagagCAGTTGCTTAGAGTAAAGCAAATTGCAGTTTGAGTACAATTGTTTTGAAGTTTTCTTG
TTCGGGTTCTAGCTAATAGCTAGACCAAAGAGGGTTGAGTTATTTGTTCTGCGTCCAAAGGGTAGTTTGCTTTCGAGGCAGAACCAGGAAAACTTGCAGA
TCTCCCAAGCACGAATTCAAGACTGCTGAACAAAGAGTAATCTGGGACGTAAAACCATTTTGGCGTAATACATTCCTTTTAAAAGACCCAGGCTTGCATG
CTTCAGAATTGTCACTAGACTAGTTTAACGAACGTGCAACCGCGTTTGCTACTAGGCTTACATGACCCCACTCTGAGCGATACATCATTGATAGGTTAAG
TACTAGGGGTTTTAGCACATTTATGGTTCGTTAGACTACCGGCTAACGCAGTGCACCACAATTTATTTTGCATTTTTTTCAAGCAATCTCGAGATGCGAG
CTTGAACATTGATGCTGGCGATTATCAAACTTCCTACGGCGAGTACATCACGCTGTTTTACGACAATTCGGTCCCGCTAAAAAAAGCCTGATCTACAACA
AGGGCCACGGAAAACAACCGCGAAAACACTCGCTCGGAAACCCAATGCACACGGCCATGAGGAGACCACAGTTTGTCTCCCGATCTCAGTGGCCTCAAAC
TGCCCCGGTCTGTCTTTTCCGTTGGGTTGCAGCGAGCCAGTACGCACGCGTGCTCGATTCGCTGCTTTTCTAGCCTCTTCCCGATTAAACCGCCTGTCGA
GAGTTCTCCTAGCTACCTTTATCTGCACTGCTTACTCTGTCGCGTCCTTTCGGTGTCTGCTCCTCTCTGCGCGATCTCCAGAGGCTGTCGCCCAGCTTAG
CACTCCGTCTTCTCACTAACTCCCGCTCCTAGTCATATCTCCTGTCTTCTCTTGGtctcttcttgatctgctcggTGCTGCGTGGACCCTctttgcagct
caagatgtTGTACTAAGAAAGACCTTCAGAGCACAGTGTATGCAAATTGCAACCAGGAATCAAGTTGATGTATTCACTATGGTGTATTCCATAGCGCAGC
AAGGGAATTGTGttttccacttcaagatACACCAATATACCGGTAGGTACCGGTATCTGCCGGTATCTCTCGTGGTCGTGTGCTCACCGCCCGCGGCAGA
CCACGCAAGAAAGAAGGGGTTATCCACAAGCCGACCATGATCACCCGCGGAGCCACGGACCATGCCAGTTCGCACAACTCGCTTTCATCCAGGGCAGGCA
CTGCCCCGTCTGATAACGAGGATCCAGCGGCAACGGCGGCTGTCGCCGACGTCGTGGATGTCACCGGCGCGGAGGAGCCGTGGGAGGCTGTCCCAGTGAG
ACGCACGACGAAGCCGACGCCACTGCGCCCCAGCAAGCGAGCGCCAGCGAAGGGTGTCACCGGTGCGGCCCTGACCGAGGCCCgcaaaggcaagaagagG
CTGGTACGGCACCCTGCAGCCGGCAGCGCGCCTTCCAAGAAAGACACGGTCGACGGAGGCCAGGGGGCAGACTCCAGTGcggaagagaaggctgctcCCT
CGGCCGTGAAGAAAGCTGGAAAGGTCCCGGCTGTGGTGAAGGTCCGTGCGAGTGAGACACCCCCTGCGCCGAAGAGAACGACAAGGGCGGACGGCGGCTT
CAACCTCGACGCTTTCATGGCTTCGTTCGAGCCCGGCACCCCCAGTGCCGACACCATTCCACACGGCGCCACCATGCCTGCTGTGGATTCTCCCGCGTCG
GCGCATGCTGCTCCGATGGGAGCCGAGATGGCGGCACAACTGCGCGCGCTGCAGGTCGAGGCGGAGCGTCTGCGCGCCATGGTGGCGAGTCAACCTCACG
CTCCAAGCCCCACCGCTGTGGCCCCAAGTTTCGTCTCATCGGCTCCCAACGTGCCAAACGCGAAGGGAGAGATGCCGCCAGGGGAGGTGTGTTACCTCAC
GACCGCGAGTTTTCCTGAAGGTGCGAAGAAGGGCAAGGGCGACTACAACCCGCCGCAAGCACACTTGCTGGCAGCGAGCCGCATGTTCCGGGGCTTGGGC
ACGGAGACAGGTAAGACCCTGTCTGCCATGTCGTTTGTGCTTTGGATGTGAGAGCTGGAGTCGGTCAAGTTCCAAGTCACGCCGGCCATCTTGATGGCCA
TCTTCAGCGGTTGCCTGGGATCGCGAGGCCTGAcgctgatgcacttcaaggAGTCCTCCGAGATGGCGTCTCTGGAGGACGGGTCGACCAacgccaactt
ctccagcgacttcAGCCCCTCCGCGTCGCTACCCCCAGCGACGATCCGCTGTGCCACGTATGAAGACATCCTCGACGGTCTACATGGGCTGAGTGCCCTG
GGGCAAGGTGTGTGATATGACTACATGCGGAAGCTGACGTCGCGCCTCCGCATCTTCGTGGCGAGGAACAAGTCGGCGGACCCTGGCAACACCCCGGCAC
GGGTTCGGCTCACTCTCCTGTATGCGAACAAGCTCATCGGAGCGACGCTTGGCCACCTGCAGGCCGATGATccgcagtggtggagtggaCTCTCCGAGGC
CCTGCGTGGGATCTAGTACCAGTCGCCGGTGTGGACGATGGCACTGGTCGGCGCCCTCACTCAGGAGAAAGACGTTGGATCCCCGGACGCTCCCCCGCGT
GGAAGTCGCGACTCTGGTCGTCGAGAGACTGCGCGCCGCCCGGGTATCCCTGATGCGATCCGGTGCCTGATCCCGATCAACCGGAAGGGTCAGGAGCCAT
GCCTGCTGAACGTGGCCGGCCTCCCGTGCTCTGGAGGCAGCCGCCAGCGATGTGGCAATGCCCGCCGTGTGCACGACTGGCCGGAGCGCCTCCCGTCGCG
TCTTCTGGAGTGGATCGAGCGCACCTACGGCGGGCGTCAAGCGCAGCACGAAGATCGTCGCTGACGATGCCGTGAGCAAGCAAGCTGGGCTTCTCTACGG
ATCGAGACACAGGATAAGCACATAAATACATCACGTATTTCGCCTATTTCGTCTTCGACCATCAATGAAACACCGGAACAACCGCCGTGTGTAGCGGTAA
GCGCAACCCCCCGAGAGGTGTGTGGGGTGGTAGCGAAGCGTGGGGGAAGAAAATGGGCGTGCGAGCGGAAAAATTTCTACGGAGCCGACTGTTTCCCCCC
TCGCCCGACCTCACCGTATGCCCAGACACCTAGTGTACCGCGCCATCGATCGCGCATTACCGGATATCTGCTCCTCGGTGCGACCGATGAACCTACGTCC
CGTGGTCAGCcctgcgactgcagcaacaattcatGCCAATGCGCGCGTGCGAAGCGACTTACTGCGTCTGGCCGGCAGAGCAACGTTGGCCAAGGCCATG
GCAGAGGTGGGAGTCGTGCTTCCGACTGACGACTTCCCGTTGTCCCTCGTCGGTGCTGCGGGTCCAGAATTTCTG