Description :
From Genome Similarity Track
Location :
Scaffold_1895:14- 2798
Sequence
2784 bases(100 bases per row)
TTTTCCCTCAACCGATAATTTTACAATGTTTGTTCCATTTTTTATTTATTATATACTTCTAACACTTTTCGATTAACCTGATACAGGCACTTGCTCTGTT
TTTTTTCATGTTTCTCCTTGCTATGTTTGGCTATCAATTTTTCTACATCCACCAGCAGCTATACTCGTCCTAGCGCTCAATAATGTGCAGCACATGCCAG
CTACATCTGGACGTTATAGTAAGAACTCCCTATGTTGAGGATGCTGAAGTTCCGCTAGACCGCTACAACGGTGGAGTGTATCTTCCGCTTGCATTCTGAA
CGTTCTGTAGTGGAGAAATCACAGGTGGATTGCGTAAGAAAACACCGCAGCACCAGCGTTATCGCTACTTGCAGATGTGCATGTGAAGCAGCAGGCGGCG
ACATGCCTGGTCTCTGATGCGTGGGACCTGGTGTGTTACACCGGCTGAAAGAGGCTCAACATAATCAACGTCGGTCGACGAGTCGTGTTTGCGTGAGGAA
CGACGATAGGTTGGTGAGTTCTCCAGCAATTCGTGGCCAATTGCAGAATGAGCTGCCCCATTCGAGTGGTGCGACAGCAAAACGCAGCGACCGAAACGGG
AGAGTCCACTCTCCGCATGAATGTCGATGGCAGAGGAGACGGAGCTGCAGGACCGTGAATGCCTCTTTTCGATGCTGTTGAGCGGTCCAATTGACCATGA
ACCGTCGTGGGTCGAAGCAATCGGATGGCCCCCATTTCTCGTCCCGAGTGACCCACAGTCTTTCATGTTCTACCCACTTTAACCGGTCTGGCAGCTCCCA
AGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCG
TCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGA
CCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATC
TTGGATCCGACTCCCATCCACTTGGCACTCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTT
TCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGG
ATCCAACATCCTCAGATCCACGGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTG
GTGTTTCTCCCAATAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGACC
TTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGC
AATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCT
GGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCATGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGAT
CTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATACAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTG
GGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCG
TTGGACGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGA
CACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCG
CAGCACTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTT
TCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCT
GCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGAT
CTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCG
ACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGAT
CATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAA