Description :
From Genome Similarity Track
Location :
Scaffold_2115:14- 2688
Sequence
2674 bases(100 bases per row)
AACTAGCTACTGGAAACTGTGTCGAGCTAGCCTTTTTGCATAAGCTATTATAATCCACACTCCCTTACTTGAATATGTCTGTAACATCTCCTCGTCGGTT
GAGGAATCCAGTCAAAGTCTACTGGCGTACACCTGGATCTGGGTTGGATCCACCCTTTCGGCGTACACCTGGATCTGGGCTGGATCCACCCTTTCAGCGT
ACGCCTGGGTCTGGAATAGATCCACCCTTTCAGCGTACACCTGGATCTGGGCTGGATCCACCCCTTCAGTGTGCGCCTGGATCTGGGCTAGATCCACCCT
TTCAGCGTACACCTGGATATGGGCTGATTTTCGGGTCCGGATTGGATCCACGCTTAAATTCCATCCGGATCGAGCTCCTACGTCCCAGTCTATAATTAGA
CTCGTACAGTTCGGGCTCCCGAAAAACTCGCGCTTGAAATCAAGCGGGACTCTTCGCACGTAAAACGTCACTCTTTATGCATAAGCATTAACTCCTTCCT
CCTGATCCACACCTCTCTTGTGAATTCGTCTTCTCTTTCTTTCCAATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGACCCACACCCTTCCTATG
GGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATT
CGTACGATCTCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAAT
TCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTCGAACTTGTCGTCTTCGAGATCCACATTCCAACTAT
CTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACTGATCTGCGGCCGATCCGGGTATTCTTTGACCAACTTCAGCTT
GGATACATGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGC
CATGGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTAGATGTGGACGGGCATCTTCGT
TGTGTCGATCCGCTCGATCCTGTATTGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCTGGTAGTATTTCTGGACTTGGTATCGCCATCGCCT
TGGATCTCGGTTTTTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTGTCACCC
CGGATCCTGTCTTGAGCGGTGCTCATCGCGAAGAGGAGTCGTTCTGCGTACTCATCCCAATCCCCCTGATCCAAATCCTGGACATACATCTTGAGTGCTC
TCGTGATTGTCTGCACCATGCGCTCGGCCGACCCATTAGCTTGGAGACGGTATGCCATGGTTGCTCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCG
AAAGAAATCAGACATAAAACCTGGCTCTCGGTCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGTACTCCTCGTACGATTCGGCAATGGTT
TGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCAGCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTG
ATCCATGGCTATGCTTTGGTAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGACCTGCCCTTGCCTGTCTCACAATCCACACA
TTCACCGACATATCGTTGCACGCTCTTGAATAGCCCCCTCCAATGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCTTGATGTCCACCTTCT
AAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCACCACCAGTCTCATCAATCCATCCTGATCCTCGCTAACTCTCTTCGTAGGGG
GACAATAGAAGAGCAAGTCATTCAGATCCATTGCATAATCGGTAGCAATAATACTGTAGGATTTGGGTATTCTCCCCTACCCCAGTTCGGTTTCGTAAAA
TCTCCCCACAAAAACTTTCTCCGTCTCCAGAATCCCGGCTTCTTCTTTTGTGGCTTGAGGATCCGCTCAATGCAGATCCCCTTCACAATGCTTCGTCGAG
AATCTGGGAGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATTACCTGGACTGTCCTTTTTCCAGATCCAACCACCACCACCTCGTCTAGTCGG
TTCAGCGTGACGAGATCCTGATGCTCGGCCTCTCTCTCCACCTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATTTGCACTGGCATTCC
AATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAATAGTGTTAGGGCCAGGGCCGTGCAGTCAAT
CTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCCACAAATCCCCAGCCTTTTCGGATCCTCTTCCTTT