Description :
From Genome Similarity Track
Location :
Scaffold_2992:14- 2411
Sequence
2397 bases(100 bases per row)
CATAAAACGCTGGCCATGGTCAAGAGAGCTAGTACCAGAGTACTTTTATCCAAAAATTCCCCCAATAGCTCATTGATTAGAGGCATTGGATACACCATCA
ATCGGGTCAGGCCCGTTAACTAGCCGGGTAATCAAATGCACAGACGTATATCCCACCCCGTTATTCTTGATGATGGCTACCACCGGAGATGCCCATGGGG
ACATTGAGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTGTTTCTCGAAATTGAGGCGCCACCTTCCGCACCCTCTGAGCGAT
CGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATT
TTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGACCCACTTGGATATCATCAATCGTGACCTCTTCTGTGGTCAGTGGTACCTCCGGGA
TCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACCGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATC
CAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGAGGGATCAGGTACCCTGATATCAGGGAAATTACCAGTTGGATCTAGTCGGTCCTCT
AACGAGTTTAAGCTCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTTTTCAATGGAAAGCTTGGATCCACTTGTGGAT
CAGCGCGATCAGCATGTTCGGCTTTAACCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGA
TCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCC
GCCGGGAGCTTCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATC
CAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAACAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTA
TCGTGATCGACCTGGTCCCTGGATTACGGTCGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACCGATCTGGAAGT
TCCCAGGTCTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGTCGTCCGCTGAGCTGGATCCGCA
TCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACGATGAAATCCGTCCCGAGGATGGCGTCTTGACCAGCGAGATC
TCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACA
CAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGTACCACTATCTAGGAGTAGGATTG
TTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATC
CATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCA
TGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATACAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATTCACTTGGCGCAAACTAG
AAACCTTGGCAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGGTATAGCGATGTCTTGTTCACAAATGTATA
AATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCTGGCAACATCCCTCTGTGCT
TGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAACTCTTCCATCGGGCACTTGCCGACGTCATGAATCTCGCCACAACCGCGACACACGTGGAAGCA
GTGACCTCCGGGATGACCCTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAACATCCAGACTCTGTGTGCTTCCGGGATCCGCACTGCGAGCAC