Description :
From Genome Similarity Track
Location :
Scaffold_4055:14- 2388
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4055-fgenesh-gene-0.0Anoctamin

Sequence
2374 bases(100 bases per row)
TGGATGCCCTTGACCACGCCCACGGGCTTGGTCGAGTTCGTGAGCACGAACACGTAGCCCGAGAGCACTTGCTGGAAGAGAATGCTGCAGAGAGGAGACA
CAAGCAATACACGTGTGAGCGCATACACATAGAGAAGAGCAGCATAGCGGTGGCTCACCTGCGGCCGGCCCAGTAGAAGAGCGTGAAGACGTAGGCTGTC
TGCACGTTGTGCGCGATGCGGCTCCACCACTGCATCCTGGCGTGAGGCTGTTGGCTGTTGGCTCGTGCAGGTCGAATTGGCGAATGGCAGAAGGCTGGGG
AGCGCCGGCGGATACACACATCACGAGCGCGAGCAGCTCTTGCTGCGCAACGGCGCCATCTGGTGAGTGTGATGGCGCCGTTTATTTTCTCCTGGTTGTC
AACTCTTCTCTGTCAAAAAATATTCTTGTCATAACTAATAGCAAGCTACATTTGCTTACCTAAATATAGGTCAGAAGGTTTCCTTCTGTCAGTATCTTCC
TGGCTAAATCAATACCCGTTAAAAATGATATCAAACTATAAAAGAGTGTCTGCGACATGTGCGAATATCTTCCCGCGCTTTTTTTTTAATGGAGCTCTTC
GCGTTCAACCCATGGCTAAGCCAGCACTTCAATCAGCACATGCGCCTCATAGCAGCACTCAATACCTTGCTTCACGATAAGACACATTAGCCTCAAGCTT
GCTTGATACTATCACCATGCGTTCTACGAATCGACCGCCTACTGGATGCCACTCGAGAGCGCTTCGTCAGCAACGCCAGCTGTAGATGGCTTGATCAAGC
TGGGCCGAGACTCGTCATCGCCATCGCTCCCGTCGTCACTCTGCAGCTCGTCGTGCTCCGCATAGGCGGCCTCATGTGTGCGATGCAGCGCCGCGAGACG
TTTCTCGTTCTGGATCCACGTGGGCACGTCGGGCGCCGCCCAGTTCAGCAGCACCTTGATGCAGAAGATCAGGTGCTCGCATGCCTACATCAAGACGAGA
CAAGAGCTGTCAGTATACGCGCTATAACTTGCTGATATAGGATCAGCAACACTGCGCATGCACTCACCACGATGAACATGAAGCGATGCAGGTCTGACCA
GGACGGCAGCAGGTCGTCGAGCTCGTACGTCCACACGAGTGCAAAGTTGATGATGACGGCGAGCACGGAGAAGGCCACAAGCACGTGCTCCCAGACGCCG
ATGCCGCGCGTGTGCTGCACGAGCGGCCGCTGGTAGCTGTGCGTGTTGACGAGTTTGAGGAAGTCCGAGCGGCTCTCGACTACGTTGTTGAGCCACGCGA
AGACCGGCGCGAGCGGGAAGATGGGGCTGTAAAGCGCCACGTAGCCATACTGGATCATCATCTCCTTGTAGTCCGCGAACGTGTCCTTGTACTGCGCCTG
GCGCCGCTGCATGAGCACGCGCGCGACGCGCTCCTGGGCCGACGCCTGCGACGTGTGCTGCCGCTTCAGTTCGCTCTGACCTCGTTGTCCAGCCACCACC
GCTGAGCCATTGGTACTACTGAGCTGCTCACTGAAGTCGCCACTGCCCTGGCTGCTTCCTCCTCTCGAGCGCCGCCGCTGGCCGTCGGCCGTGAGGAACT
CGCCCGTGAGCGAGACAACGAAGGGCAGCCCGACCTCCTTGAAGTTGTCGAGCAGCTGCATGCCGACCATGAGGATCCAGAGCCGTTCGCGCACGCGCTC
GAGGTCCTGCACGTAGAAGGCGAGGAACCAGATGGACGCGTTGCTGTTGACGAAGTGGAACGGCATGCGCTTGAGCACGAGGTTGTCCTCGAACTCCTGG
GCCGTGCGGTAGTTCTCGAACTCGTTCAGGCGCCACGCGAGCTGCTGGTACATGAGGTCCATCATGTAGATGATCAGCGCGTTCAGTACACCCGGCCCGT
GCGAGATGAGCGCACAGAGCGCTGGGCTCGGCGAGCCCTCAGGCGCAGTGCCATGTTGATGCTGGCCGTGCTTGAGGAAGCAGGGCCGGTAGTGCGAGCG
TAGCTGTTCCGAGAGCATGTTGAGCCCCACGACGTAGGCGCCGACGGCGCAGCACATACTGAGCAGCAATGGGATCGCGAGCAGCTGTCGGAAGAGCCGC
TTGTGGCGTGGAAAGTCGTAGATGAACTCGCGCGTGACTGGGTCGCTCATCCACTCGCCCTGGAACTCGGGGCGGGTCTCAATATAGTCGAGCCCCACGA
GCCCAGGCACCAGAGATGAGGACGAGTCCTCGACGGCCTCCTGGTACTTCCACCTGTACTCGACCTCACGCTGCTTGCGGCGCCACAGGTCCACGAACAC
GGACGTGCCGATGGCCAGCAGGAACGACAGCAGACTGTAGCTCTGGGCGTTGAAGTGGCCCGCGGCGTAGACGC