Description :
From Genome Similarity Track
Location :
Scaffold_1640:14- 2312
Sequence
2298 bases(100 bases per row)
ATTAATGATGCAATTAACAAGCTCAGTTTGACCATCGGTCTGCGGATTATCCGTTGTAAACATGTCAAACGGGTGCCGAGCACTTTGAAGATGGATTTCC
AAAACTTCCCCAGTGAAGTGGGGATCTCGATCAGAGACAATTGCCACTGGCAAACCATGTTGTCGAAACACACAGTCCATAAACAGCTTCGCTGTACCTT
CGGCATCAATAGAGTCCGGCACTGCCGCTAGATGAGCCATCTTTCTCAATCGGTCAACAAAGAACACAATGCCAGTGTTGCCTTCCGAATATTTCGGTAG
GCCAAATACAAAGTCCATACTCATGGACTCCCAACACCCAGTGGGTACAGGTAGACCAGCCAGCGGCGCCGCCACATGTGCTGAGGGTTTCACCCGTTGA
CACGTTTCACACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTTTGGGCCACCAATAAGCCTAATTTTACTGAGCTATAGATCTTCTCACGACCGA
GATGACCACTTAAAGCGGTATCATCTGCCTCATAGAAGATTCGATACTTCAACTCTTCATCATGAGGGACAGTGATACGAGGGTTATCCATAATATCTGT
GCGATAGCACAACAGCCCATTATCGATAGAATATCGATGTATCCTCGCACGTAAACGTGCCGAAAATTCTATGTCCCAGTCTTCGAACTCCTCCCTCCCA
AGAGCATGTAGCAAATCTACACATTGTTCATCCTTGGCATCAGCCGCACGGATAAAGTCAGCGACTGACGATGACACTGTAGTGACGTGAGCAAGTTCAT
AGTCAGGTCGGCCCGATAGCGCATCAGCCAAAGAATTTTGCTTTCTTGACTTATACTTCACTTCGAAGTTATATTCGGCAAAGAATGAGAGCCAACGAGC
CATTTTCTGAGAGAGATGCGGCGACTGTGTCTCAGTGTGCAATGATGCATTATCTGTATAGATCACAAATGGCTTTGAGCCAAGCAGATATACTCTGAAT
TTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGCTCTTTTCAGCAGCTTTGAGCTGTCGAGATTCGAATGCAATGACGCTTT
TGCGTCCATCGACATCTGTTTGTAACAGAGCACTGCCTGTGGTAAAGTCATATGCGACATAGAAGACACTCAAAGGCCGATCAGGATCGTACAAAGCCAG
TATTGGCGCATGAAGGAGACTTTCCGTAACTGCTTGAAAAGCATCATGTTCGGTGTTACCCCAACACCAATTCACACCCTCCTTAAGGAGATTGGATAAT
GGACGAGCCATATCTGCGTAATTCGCACTATACTTATGCAAGTAATCGGCAAGGCCAATCCACTTACCTAGATCTTTTTGGTTCTTTGGAACCGGCCAAT
CAACTATGGCCCTTATCTTAGCGGGGTCCGCTCGAAGGCCTCTCTTCCCAATGAAGCACCTCAGAAAAGGAATCTCTTCTGCATTTGCATACAATATATT
TGTGCGCAGCACTCGAGCACCGCTCGTAAGTGATCAATGTGATTATCCACATCAGAACGACCGTTCGTTGCATAACTATGGACAAGGATGTCCTCAAAAT
ACGTTTGCACATAGCCTCGATGAGGTCTGCATAGTTGCGTCACCAGACGATTAAAAGCAGCCGGGGCATTTGACAACCCTTGTGGCATAACGAGCCACTC
CCAGAGCATACCGCTCGGGGTACTAACCGCTGTTAGCGGAATATCGCTTGCTCACATGAGCAGCTAGTAATAACCATCGACTAAGTCGAGCGCACTGTAC
AATGTACATCCCACCATATTGTTCTGAAGAACATCCTTTCTGGAGATTGGTATCTGAGCCGGGATAGTGGCTGCATTGAACTTATTATAAGCGTGCACAA
TACGCCACCTACCATTAGGCTTTTTGAAACCAAATGTAGGTGTGGAATGGGGAGGCTTACTCTCCCGCACCATTCCCGCCGCGTGCTTAGCACGTAAGAA
ATCGTCAATGACGTCACACTGTTCCGTAGGTAAAGGCCACTGCCGTGTTACGTAGTATTTAGTTCCTGAAACTAGGTCAATTTCATGACGTACACCTCTA
TCGGAAGGTAAGCCAGATGGTGGGTTGTGACCCACCACATCTTTAAATTCCTTTACCAAAGGATAGAGTGGATTCAAATTATCTTTAAGGATCGAAGATC
CACTCCGGGCACTGAGTGCTGCTTTGGTGTCCTCTAGGACCGACTCATCCATTAATGAGGACGAGCTCAACTCGACATCGGGTCTAATTCGGATGAAT