Description :
From Genome Similarity Track
Location :
Scaffold_3760:14- 2114
Sequence
2100 bases(100 bases per row)
GGGGAATATATCAAGACAAGCCCCCTGCGGCGCTTTGGAGAAGTCTCGATACTGGGACTGATCTCCGGAGCGGCCACTCCGGTCACACAATATTCGAGCC
GGCACGAGATCGATCTCGTGGCGATTCCTCGTCAGCTGGCAACTCAGCTGGGATCTATCCGGAAATACATCTTCATATTCGCGGGCGGTCTGGTAGACTG
GATTGCGGATTCGCGTAGCGCGTCCCAGACTGCGCTGCGAAGCGCTCCTCGCGGGCCGACTTCGGCTCAGCGCTCTTGGGCGCGAGGGAGGCGTCGCCGT
CACTGACTGCATTCACTTCGAGCGACGCGATCGGCGTCGGTGATCAGGCAAACTGTTCGATTCATCGTCCTGAGGCCGCGAAGGAGGTTCTTTCAGGAGA
GACCCGGAAGAGGCGAGAGATCGACCCTGCCTCGCCAGGCGGGTTTGCAAGCTCGAGTGTTCGTCGGCGGCCAGAGGTACCTTCCACATACTCAAGCACG
CAGACCGACTCCGTCGGTGAGCTGTCACTTGGTACGGGCTCTCGGCGAGGTTTCAGCCGACGCCGCTTCGACTTCCTCTTTCGCCGCCTCGAGTGCGAAC
TCGAGGATGATGAGTCGCTCTCGCTGGACGAGATGTCACCCCCCTCTAGCGGGAGCCCCTGCTCGACCGCGGTAGTGTTCAGCGGGAGCGCCAACTGCTC
GACCACCGGCTCAATTGACGGGAGCCCCTGCTCGACCGCCATCTCGTTCGTCTGCGGGAGCCCCTGCTCGACCGCCATCTCGTTCGTCTGCGGGAGCCCC
TGCTCGACCGCCATCTCATTCGTCTGCGGGAGCCCCTGCTCGACCGCCGTCTCGTACATCTGCGGGAGCCCCTGCTCGACCGCCAGTTGGTCTTCATCCC
CGCGGCGCCGCGGGGACTCGTCAGTTAACAGCACTGCGCAAGTCGTGCAGAGAGGGCCATCGCTCACTCTGTGCACAACGTGCGTCGTGGATGACCGGTC
CACGACGGTGACGTGAGGCCAATCCTTCTGGGCGACCAGGAGGTGCGTGAACACCTCACTCACATCATAATCACTGCGGCGCTTGACCGACCGGGCCAAC
CAGTCAATCTCTGGTTGATAGCGCGTCAGCCACGGCATACCCAGGATGCAGTCAAACGCGTAATTCATCTCAATGACGAAGAAGTCGTCGTTGCTTCGGA
AACCCGTCGAAACGTGTACGGAAGGGTAATCTCCGCGCCGCGCGACGCGGCGTGATTTCCCATCGGCCAACTTGACAGCGACCTCCCCTCTACCTTTGCG
GACAGTGATGTCCGACGGGAGTACCGACAAGCACGACGCGCGGACGAAGTTGTTGGTCGCTCCTGAAATCAAAGGAGCGCTCGCAGTGGTCGCCGGGCAC
CCGGCGACATGAAAACTGACAATGATCAATCTTGAATCGCTCGGCGTGGTGGTGGCATGAAAGTGTGCATGCAGCACAGGAGGGCTAGGAGATTAGGTTG
ACACCGGGGGACCCGGACCTCCATTCCAGCCAGTAGGGCGCCCCGCACCTACTGACCCTGACCGTTTTTTGGCTGGTCAGAACTCACGGGCTCGGCATCG
ACATGCGCAAGCACTGGAGCTGGCGCGCGGCACTCCGCCGCGCGGTGACCGACCTTCCGACAGCGGAAGCAAGTGAGAGAACGATTGTTCAGAGCACCGC
TCCGACGCGCTGCATAGCGCTGACGATTGCTCGTCGCATCGATAGCGTCGATGTCCATGGGCTCGGGCGCAGAATCCCGAGCAGAAGCAGGTAGCGCGTG
AGCGTATGACGCCGCAACCACGTAGTCCTCGCGTAGGGCGAGGGCGAATGCCTCTTCGAGCGTAGAGGGGTCCGATCTTGTAAGGCACGTACGCACGTGC
ATGCCTTCGCGCATACCGAACACGAATACATGAACCTGAGAGGCCATATCGATCGGCTTAGACACGATGCACGACGCGAGGTGTCGTGTCTTCTGGACGC
ATTCGCGCATAGTCATCCCTGCCTTGCCGGAGGGCGAAGAAGTCTGCCCATATTCGGGATTCATCTTGCGGCGGCTCGAACGCGAGCCGAAGGGAGCTCT