Description :
From Genome Similarity Track
Location :
Scaffold_1687:14- 2024
Sequence
2010 bases(100 bases per row)
CTACTGATAAGGTTATCTTCTTCGATGTCGACTTGATCGACCATCGGCAACGTCGCGTCGTCGATTACCTCGACACGTGATGAGCAAGAGCCAGAACGGT
TGTTGCTCGAGCAAATCCCTCCCCCCCTTGAATATTGTCACACTCTTAATGGGTGGGTAGGTGTGGATGGAGTAAGCCATTCACGAAGAATAGTGTATGC
GTTATCGATGCATGCACGGAGTTGTTGATAGCAAACTCCCACCCATTGGCAAAAATTCGCTCCAATCTGTGAAAGATTGGACGTATCCTCGAAGTATCTC
TTCGAGGACGTGGTTGAAGCTTTCTGTCTGACCATCAGCCTCGGGATGGTCAGAAGTCGATATAGTCAGACGTGTTGCGAGGGATCGGAACACGGATTGC
CAAAACGTCGCCGTGAACCGAGGGTCTCTATCAGAGACTAGTTCACGGGGTAGACCGTGGAGTCGGAATACCGTGTCAATGAAGACACGGGCACAAACAT
GTGCTAAGTTTGACCTATTAACTGCAGCAAGATGGTACATCTTGCTGAAACGGTCTACGAACACAAGAATACCATTATTCTTGTGAGCGTTTTTGAGGAC
CCCGAAGCCGAAGTCCATTGAAACGGACTGCCAGCACTCTGCTGGGATTGGAAGAGGCTGTAGTGACGCACGGGACGAAGGACTGGGCTTCACCCGTTGG
CACACTTCACAAGCACGAATGTACTTGCGCACAAACAGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACCGTGAGATAAGTATTCTCACGCCCACGAT
GCCCACTAGTTGGTGCATCGTGACACTCGTACAGGATGCGTAAGAACAAATCATTATAAGAGGGGACGACGACACGATGTGTGTGGCCGGTAACGGCTGT
ATAATACAGCAACCCGTTGCGTGTTGTGTATCGATCCGCGGAAGGTCGATACAAGGCCGGTAAATATTTGAGAGATTTGAGAGATGGAGCCACCAGATGA
TCCATTAGCCACAGAAGAGCCTTATCTTCTGTGTAGGCTTTTCTGATGTCGTCAAGCAATGTTGACGACGGGACACTAGTGACTAGTGTTTCAACAGTGG
TATTAACCTCACTGTTGGACTGCGCAGCCGACTCGAAATCGGGTCGGCGTGACAACGCGTCCGCGACGACATTAAGTCGTCCGGGTTTATAATCTACGGA
GAATTTGTACTCCGCAAAGAAGGACAGCCACCTCGCCATCCTTTGCGAGAGGTGTGGGCTGTTTACGACCGTGCGTAATGACGCATGGTGCGTATAGACT
ACAAACGGCCTATCTCCAAAGAGATAGACGCGAAACTTCGCTAGTTCATACTTCATGGCAAAGAGTTCCTTTTCATGCACTGGACAATTACGCTCAGCTC
ATCTCAGCTGAAGCAATTGAAAACTGACGACACGCTCTGCGCTGTCTTCATCGTACTGCAAAAAACGAGCAGCCGATTGCGAAATCGCTGGCGTCACAGA
CCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAGCTGGGCGATTGCATTACGCTCTGCTTGATACCTTCAAAGGAACACTGACAGTCAGCGTTCCA
TGACCACTTCACATTTTTCTTGAGTAAACAGGAAAGATGCACAGTCATCTCGGCGTATATGCGCGAGTACTTGTGTAAGTACATTGCTAGATCAAGGAAC
TTTCTTATTCCTTTAACGTTGACTGGCACAGGCCAGTCGGTAATCGTCTTGATCTTTTCAGGATCAGGGCGTACGCCGTATTTACCCACGATGCACCCAA
GAAGTGGTATTTCGCTATCAGCGAATATAAACTTCTTGAGGTTGGCGTACAGCTTATGCTTGCGCATAAGTGTAAGAAACTGACGAACGTGAGTTCTATG
AACCTCTCTACGTCCGTCTTTTCGCCCATAGCCCGGCTATGGACGAATACATTGTCGAAGTAACTCGGTGTGAAGTCTCGCACCGGTCTCAACAGATTTG
TAACACATCT