Description :
From Genome Similarity Track
Location :
Scaffold_240:14- 1871
Transcript NameFunction/comments
Phyta_totarag6043hypothetical protein
Phyta_totarag6044hypothetical protein

Sequence
1857 bases(100 bases per row)
GTGGCGTCGGCGGTCTGGGTGGTTTGGGCGGTCTGGGTGGTCTTGGTGGATGGGGACCCGGCGGGTGGGGCAATTGGGGAGGCTGGGGCGGCTATGGTCC
CTAccgcttcggcttcgtgcGCGGCGGCTACCCTGGCTGGGCCTACCCGATGGGCTACTGGAACATGTATGGTGCGGGTCTGTACGGCGGTGGGTGCGGT
CTGGGCATGTCCTACGGCGGTCTCTACTACTGCTAAGTTGGCGACTTGGTAGTTGAAGGTTGCCATAGAAACTGGCGCCCTTGCCTACGCGATTCAGCTC
ATGCTTTTGTTTCGCTCATGAGGCTTTGGAATAAACGATTTCTTTTGACACGCTTTGATGCAGTACGGGTTAGCACTGCCACCTTCGGTTGATATGACAA
TATACCCGCACGAGGCTGCTCGTCTCTtcgatcaacaacaacaacaagttTTCGAGCAAACAAACTCATACTAACACGTACGCAATCGTAAAATAGTTAA
TGTGAGCCGAGGTAGTTTTTCTCGGATACGCGATGAGACCTAACAGAAAAATGGCTACGATTGTAGGCGTGTTGACTGTGAAATAAAAATAGAGAGACCA
CGATATTTAGCCCCGGCAGCCAACGCCTTGCCCAAATCTACGCAATACTCGGAGTCCAACGGATAGCACTGCACCATACCCAGGACAGTCACTATTAAGC
CGTAAAAAACCTGCATGATCTCCCATGCGTGTCGAAAGTGGCGGTCTAAATGTAGTTGGTGGTCGTCCGACGGCCAAAACTCAATGAATGAGCGATTATT
TCTTCTCATGACGACAAGGTCTTAACTTAGTCGAGGACTCTAAAAATATTGATCTTCGCTGCTCCCAAACCCCACAGGTGGAACACTACCCGCAGAAGGC
AGTGACGATGGCATCTGCGTTTGCCATGAGTCCTATCCAGCATCCAGGAGCCAAATTCGCACGAATGGACCCGATTGACCCACGAGCGATGggtgcagca
cgaagacgacgaaaagAGACTGTGAACGAGAAAGTGGAGCACATTCTGCGAGGAGCATTGCGcgacgccgaagaagacgcgtTGCAGGAGCGTGAAGGTG
GCCCTGAAACGCGTGGACGGGCATTGCAGCGCTCACGGCAACTGTCATCCTTGTACACAACTTCGACAGAAAGCAAGTTCCTGCGCTCTCGAGCGAAACG
AGATGCGTCAATCCAGCTCGGTAAAGAGACGAAGGCCAAAGGAGACTCCGAGTCGTCGATGACACGTGTGAAATCAAGAGCAGGGTCGGATTGCGTAGTG
AGGGCGATCGGGGAAGGCAACGAGAGtgacgagagcgacgacgacacatTTTCAGTGGGGCGGTTGGTGCTAGCGTCTCCCATTAAGCCAAGTGTAAGCT
TACCATCTCAATCCCCGgttccgacgacgacgacgtcaccTGTGAAACTAATCAAGCCATGGTACAGATGCAGCCCCACAGCAACTTTGAAGGAGCAGAT
ACCACCAGGAATTACTCTAGATGCGAAGTTGCGTCGCTATGGAGCTCGAGGCACGGCGAAACTTCTTCACGGTTGTAGGTCTCAAGAGGCTCTTGAACCA
CTTTCTCCGAATCACCCGCTGGTTCCTGTTGACGAGTTTGTGCCGGGGATTAGCGGGTCACCTTCGCTTTGGCGGCCAGAAACTTTTCACCCGACTGGTT
CTCGTCTGCAGGTTACGATGACACGTTGTCCCTCGTCTCCTATCGCTGTTTCTGTCGATGTTTCTAGCTCAAATGATGACCACAACAGCTCGAATCACTT
CGACCACTGCCATTCATTTGCCGACACGCGGGAGACtttgcagcagaagacaaCGGA