Description :
From Genome Similarity Track
Location :
Scaffold_2196:14- 1596
Transcript NameFunction/comments
Phymu_g13952reverse transcriptase

Sequence
1582 bases(100 bases per row)
GATCTGGCGCATCGGTTCCTTCCTGGGGGCGATCGCCACGAGGGCTTCGTCCACCTTCGATCTTGGCGTGATGCTGGCCGCGATCGTCCCCAGGATCTCG
TCTTCACCTTTGGTGCACTTCACGATCTCGAGATCAGGAGAGCTGCCCACTGTCCGAGACGCCCTTGGAGTCCAGGTGATTTAAACAGCCATGCGAGAGT
TGAGTGTCTCGTCAGGATCCAGATCTCGCGACCAACTAGCAGATTGTAATACAGATCCAGGATCCGGAGTAGAGCCAACACCTCTTTTTCCACCACGTTG
TAGTTCAGCTCAttctgcttcagcgtccGACTGGCGAAGGCGACTGGGTAGTAGATCCGATCGTGTTCCTGAATTAACGAGGCGGAGATCGCCCACTCGC
TGGCGTACACGACTACGACCGGCATCCGAGTAGGATCGAAGTGCCGTAGGATCGGGGTTGTCCCGAtcttgctcttcaactgcgtGAACGCTTTATGAGT
GCGAACCCACCTTTCGTCCAGGCCTGACATCGCTAGATCCGGCATAGCACGATCCTGATGCACTCCATCCCGATCTTCGGGCGCCGGATCCGAGGCAGCC
TGTGCCTCCAGATCCGGTCCCGAGTGCATAGCGTGCTCTGGATCTTGGGCGTCTAAATCGAGTTGACTCAGGATCCGGCGCAGATCCGGTCGCTTCTTCA
GTTCCGCAAACTCAACCTCTCGCAGCTCATATAGGGCAGCAGCGTATACCGCATAATCCTCCATGAATCTGCTGTAGTAGTTCAGACTCCCAAGGAATGA
TTGCATGGATCTCAAGGACCCCGAGAACGGCAGATCGGTCAAAGCTAGTAGATCTTTAGGGTTGGCTTCTAATCCCTCGCTTGACACGCGGTGTCCCAGG
TAATCAACCTTGCGTAGCCCCCAAAAACTCTTTGCCACACTGATCGATAAATTCCATTCGTCGCATacgtccagcagatcctCGTCGCATAGCTGGTCCC
ACGATCCCGCGGTCACAAggatgtcgtcgatgtagGATCTGCGACTTAACACCGATGGAGATCCTGGATACACCGGATCTCCGGCGTCGAACAGATCCTC
GCGACTCTCGGTACCTCCGGATCTTGAGATCTTCAGGAACCCATACAGTGCATTGTCGATCAGGCGTTGGTAGATCTGGGGGGCGTTCTTGAGCCCAAAC
GGCATACGATTCCATTCAAATAAGCCGAACGGGGTAATGAACGCCGAGATCGCGCGAGCCCGATCCGTCATAGACACTACCCAAAAACCGCTCGCCATAT
CCAGAGAGCAGTACCACAGtgccagatccagatcttcgagaagatcgttGATCAGCGGCATCGGGTAGATCATGAGACGGGTGAGCCCGTTGACCAGTCG
ATAATCAATACAGAGTCGGATGTCCACAccattcttcttgatgatcaccacgatcGGCGAAGCCCAGGGGGAAGTGGAGTGTCGGATGATCTTGGCCGAC
AATAGTCCCTTGATCAGATCTGACTCCTTCTCCCGCTGTGCGATCGGCCTTGCATTCCCCACATCAATGTCACACACGGTAC