Description :
From Genome Similarity Track
Location :
Scaffold_2220:14- 1557
Transcript NameFunction/comments
Phymu_g13968hypothetical protein

Sequence
1543 bases(100 bases per row)
TCGCACAGCGGGTGCGGAAGGTTGCACCCCAGTTTCGGGAGAAGGTGTCAGATCTGATCAAGGGACTATTGTCGGCCAAGATCATCCGACACTCCACTTC
CCCCTGGGCTTCGCCgatcgtggtgatcatcaagaagaatggTGTAGACATCCGACTCTGTATCGATTATCGACTGGTCAACGGGCTCACCCGTCTCATG
ATCTACCCGATGCCGCTGATCaacgatcttctcgaagatctggatctggcaCTGTGGTACTGTTCTCTGGATATGGCGAGCGGTTTTTGGGTCGTGTCTA
TGACGGATCGGGCTCGTGCGATCTCGGCGTTCATCACCCCGTTCGGCTTGTTTGAGTGGAATCGTATGCCGTTTGGTCTCAAGAACGCCCCCCAGATCTA
CCAACGCATGATCGACAATGCACTGTATGGGTTCCTGAAGATCTCAAGATCCGGTGGATCCGGATCTCCATCGGTATTAAGTCGCAGATCCTACATCGAT
GACATCCTTGTGACTGCGGGATCGTGGGACCAGCTATGCGATCGAGTCGAAGATCTGTTGGACGTATGCGAAGAGTGGAATTTATCCATTAGTGTGGCAA
AGAGTTTTTGGGGCTACGCAAGGTTGATTACCTGGGACACCGCGTGTCAAGCGAAGGACTGGAAGCCAACCCTAAGGATCTACTGGCTTTGACCGATCTA
CCGTTTCCGGGATCCTTGAGATCCATGCAATCATTCCTCGGGAGTTTGAGCTACTACAGCAGATTCATCGAGGATTATGCGGTATATGCTGCCGTCTTAT
ATGAGCTGCGAGAGGTTGAGTTCGCAAACCTGAGGAAGCGACAGGATCTGCGCCGGATCTTGGGTCAACTCGATTTAGACGCAAAGATCCAGATCACGCT
ATGCACTCGGGATCGGATCCGGAGGTACAGGCTGCCTCAGATCCAGCGCCcgaagatcgagaaggagcgcatCCGGATCGTGTTATGCCGGATCTAGCGA
TGTCGGGCCTGGACGAAAGGTGGGTTCGCGCTCATAAAGCGTTCACGCAGTTAAAGAGCAAGATCGGGACAACCCCGATCCTACGGCACTTCAATCCTAC
TCGGCTACCGGTCGTAGTTGTGTACGCCAGCGAGTGGGCGATCTCCGCCTCATTAATGCAGGAGCACGATCGGATCTACTACCCAGTCGCCTTCGCCAGT
CggacgctgaagcagaacgagctgaacTACAACGTGGTGGAAAAAGAGGTGTTGGCTCTGCTCCGGATCCTGGATCTGTATTACAATCTGCTAGTTGGCC
GTGAGATCCGGATCCTGACGAGACACTCGACTCTCGCATGGTTGTTTAAATCACCTGGCCTCCAGGGACGTCTCGGGCAGTGGGCAGCTCTTCTGTCACC
ATGGAATCTCGAGGTCGTGAAGTGCACCAAGGGTGAAGACGAGATCCGGGGGACGATCGCGGCCAGCATCACGCCAAGATCGAAGGTGGATGAAGCCTTC
GTGGCGATCGCCCCCAGGAAGGAACCGAGGTGCCAGATCCAAG