Description :
From Genome Similarity Track
Location :
Scaffold_2632:14- 1438
Transcript NameFunction/comments
Phypl_g15269hypothetical protein

Sequence
1424 bases(100 bases per row)
CACCGGGGCTAACGTCTCCGCTGTTACGGAAGCGTTCGCCCGGAAGCTGCGATTGAAGCGACTTGCAAGCAAAGGTAGGCAAATCGATGTCCAAGGTATC
GCCAAGTCGAAGGTGGTAACCACATCCTGAGCGATTGTGAAGGTGATGCTCGGATGAGAAGTCGTGTACGAGTTCGAAGTGTGGATTATGCCGCGCCATG
CAGGTGTTGATCTGATTCTGGGTACAGACTTCATGATACCTGCTGGAATTAGGTTAGACATGTACAATTCCACGGCTAAGCTGCCcgacgaagtcgtcgt
cccaCTAGTCAAGTCATCGAGAGACATCGATGAATCTAAGTATGgagatgaagtcgtcggAGGACCATCGGAATCGATCGACCTCGCTAGCCGAGATATC
GCGGTATTCAAgctgcaacgacggcgacccAGCGAGTCGACACACGAACTATGGGTCCGCCAGCTCAAAGGGGTGATACCTACTGTGATACATAATGCGA
GAGGACGAGCAGGGCGAGTCCTGCTGACGAATATCTCGTCGAGGCTCGCGTGGTGTCCAGCACATTTCCCAGTGGTTATGTGGGTACCTCATGGAATACT
GTCGCGAGACGAAGGCTATGTACNAATCAACTCGGCGAAGTATCGCGATTGGCAAGTCCTGGCTTATGAAGGAGCACTCGATAAACGGCTTCTAAGGAAA
GAACAGCGACTCTACATGGAATGGCTAAGAAAACAACCGCCTGCAGTCGAACGACCGCAGTACGATACTCCCATGAAGATTAAGCGACGACTTGTTCGAA
GTGAAAGTCAACCGAGCGAGCTAGCTACCAATaacagcgacggcagtgAAGACTCAGCGATAGATCATGAGCTGATGAAGTCCCAAGCTGCAGTCAAAGG
CTCAGCGAGTACATCCGAACCCGACCCAGCGATCGCGAGACCAGCTCTCCAGGCTTTTACTTCGGGAGAAAACTCAGCGATGCAGCACGAGAGTGACGAG
ACAGCTAACCAACTAGCGTCAACACCTGCAGCCACGCTCGACGAGACGAACGGCATGGAACCGCCCTTGAGACTTGGAGACCGACTGACATGCAGAGGCG
AGAGCTCGCGGGAGAAGGTCCCCATCCAGATGGACAGGGGTGGCCTATGGGATCCCGGCGAGGTGTGCTCAGCAAAGTCAGCTAACTCGGCGAATGGTGA
TCAAGGACCAGTAGCCGTACCCAGCAAGAATCCAACCGagcgagcaccacgtcgtcccGGACTCGTCGAATACAGCGAAATCGATGCCGGTAAATACTCG
CTGGGCTCGGATCCGGAGCAAGACCTCGAGCGTCGTTTCCTCAGCGCCGTTCAAGAGATCGACGAGAGTACCAAGACCCCCATCGAGCGGGACGAATCGT
CAGGGCTTGCGGAGTACGACACCC