Description :
From Genome Similarity Track
Location :
Scaffold_3514:14- 1261
Sequence
1247 bases(100 bases per row)
AGGCCTCTCTCCCCTTCCATCTTGGTTTGATCGCCCCCCCACTCCCCTCTCTAGGTTCAAGCTCGGGTTGCCATTTGAGAAGGCTCTCGCCGATTCCACA
TTTTTCACAATCAAGTGCATGGTTCGACCTGGCTTTTCCAACTTCACCAAGCAGCGTGGTAACCGACGTAGCCATGCCGGTCGAGCTGGAAGAAAGTTCT
CGTGATCCTTGTGTTGGCGATCCAGGACGGTTGGTGTGACGTGGATGTTTTGTTGGATCCATCCTTCTTGCACCTTCCCCGACGCGGGGATAAGGTAGCT
TAGTTTCTGGGATCCGTATCCCGTCAAGCCAACTTGGAGGATCCCAACCTCCATCGCCCAGAACCCACGAACCTACTGGAGGCCTTGCAAGAGATTGATG
AAGCCGAGCCTTGGCGCATCCAGTTTCGTGGGGACCCGAGCCAGCACCCAGGACACCAGATCCAGCGTCTGGAGGGCAAGTTATTCAATGTTCAGCCCAA
GACCACCTGATCCCTATCATTCTTTGACGCCACGCCCCCAGTTTCAGTCTTCGTGGATTCGCTTCGTAGTAGTAACTAGCGACTGGAAACTGGGCCGAGC
TAATCTTTTTACATAAGCCATTCTAATCCACGTTTCCTTACTTGAATATGTCTGTAACATTCTCTTGTTGGTTGATGAACCCAAGCAGAGTCAACCGGCG
TACACCTGGATCTGGGCTAGATCCACCCTTTCAGTGTACACCTGGATCTGGGCTGGATCCACCCTTTCAGCGTACGCCTGGGTCTGGGCTAGATCCACCC
TTTCAGCATACACCTGGATCTGGGCCGGATCCACCCTTTCAGCGTACACCTGGATCTGGGCCGGATCCACCCTTTCAGCGTACACCTGGATCTGGGCTGG
ATCCACCCTTTCAGCGTACACCTGGATCTGGGCTAGATCCGCCCTTTCAGCGTACACCTGGATCTGGGCTGGATCCACTCTTTCAGTATACGCCTGGATC
TGGGCTAGTTTCTGGGTCCGGGTTGGACCCACGCTTGGATTTCATCCGGATCCAGCTCCTACGACCCAGTGTCAATCGGGTCAGTATAGTTCGGGCTCTC
GAAAGCTCGCGCTTGAATCAAGCGGGCCCCTTCGCACGTAAAACGTCACTCTTTATGCATAAACATTCACCCCTTCCTCCTAATCCACCCTTCTCATGTG
GATTCGTCTTCTCTTTTTTTCCGATGTGACCAACTCACATCAGAGGT