Description :
From Genome Similarity Track
Location :
Scaffold_3077:14- 1199
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3077-snap-gene-0.1HECT E3 ubiquitin ligase

Sequence
1185 bases(100 bases per row)
TTCACCGAGATCTTTATGAGAGTTTGCACTGAGGGAAAAAGTCTGCTCGTGCTTGTTGATGCAATGGAGCACCCCAGTAGTGGGATCTGCGAGACACTCG
TTGAGACGCACAAACCATTCGCGGTGCAATCCACCGGCGTCGACGCCAGCTTCAGCGACGAAGTTGATCCGCATCACGGATCGCACACTTCGCAGAGGGA
TCACACTCAAGGACTCGACCGAGTCTTCAAAGATCCGTCCTCGCTTCACATTGAGCTTGATGATTTCGCATTCGGCGGGTGTGGTAAGCGCCGCNNNNNN
NNNNNNNNNNNNNNNNNNNCGTCACGAAATGTGCATATTTGTCTGGGAATGGCTGTGCGCTCAGGCTCAGTACGTTTCGCCAGTGGACCCCGTTCTGGGC
TCTGTGACTGCTGCTGCTTCGCAGAATTGGAAGGCGACCAGGGTCGGCAAGTGATGAATCGACGAGATCCATCGTGATCACATCAACTTCTTGATTCAGC
TCTTCTTCGCGGTCGTGCCTCGAAAGTTGAACGCCTCTTGGTGATTCCATTGCTCCATTTATCTCTGGTCTGTTGCCTTCGAGACGTGGTCTATTGCTGG
TTGGATCGCTTGCTGTCTCGATGACCACGGAAATCGTCTCTGCGTATGGAGGTCCTGCTATTTCTCGCTTAGCGCTGTGTCCTTCACTCACGCTTTGATA
GGTGACTATGTAGCCTGGGAAAAAGGCATCCGACGCACTGGCAGTGGTGTCACGGTACCAAAACAACTTTCCCTCCAGGTCAAGCTTTCGAGTCCATTCC
TTCCGTCTCCTGCTTATATATGTGTAACCAGGCGAAGAACAAAGCATAGTCACGTTAGATTCACGGCTGTTGTTCCATAGTTAACAGTGGGCGCACGCAC
CGCGCTCGCTGTTGACGTTGTGTTGATATCGCCCATAATTGTTGCTGCTGCTCTTGGAGGCTGAGAATCTCAACTCTTGTCGTCTTTTGTGCCACACTGC
GCAAAGTTCGAACGCTCCAGAAGCTCTGCTTTTGCTGGGCAAGTATGGCTGCATCCTTGGCCTCCTTGTCCTGCTTCCACGCCACGATCTCGTCCCCACA
GAGGCTGCAAAACGGGAAGCGCTTGAAATTCTCAAACCCGCACGTTGTGCATGCATTGTAGCCATCCTCAGCTTCTCTACATAGA