Description :
From Genome Similarity Track
Location :
Scaffold_736:14- 1187
Transcript NameFunction/comments
Phymu_g11767hypothetical protein

Sequence
1173 bases(100 bases per row)
AATAGACGCCCACGGGATCAAAGGGCCCGCCACTGTAACGCGCTTCCGGAATGCGATGGCGTGTCGACACGGCAGCCGCATGGACACAGCAAATTCACAA
TCACAGCGCCAGTCGTCATCTCGGAGCTTGTATTTCTTCACGCCACCATCCACATGCAGGAGGTGTTCATCCTCCTCATCTCTCTCGAAACTGTACTTGT
CAGAATTCTCCAGAGCAACCGCGTACTGCTTTTCAACGTGTCCCGCCACATAATGACTTGTAAACCGCAGTACGTTCGCCATCTCCTCGTCATATCCACT
GTTCACAAATACTCCGATTCGTTGAAGCCGGTACTGGTATTCATTTTCCTTACGCCTGTCGTACGCCACCAAAGCTTTGATGCATTGAGCCATGCTCATA
CTGCTGTCAATCCCTTCCTTGAGCTTCCcgaagaagctctccaaACGGTTGTTCGTATGATTGCTGAAATGGGGCAGATCAGACCTGTGATACATAACCC
AACGCTCTTGACAAGTGTCCCAGTTCTTTTGGAAGTAGTCGAAAAAGCCACCGACTTCAATACGTGAACACAGCCCCCGTAGTGATTCATGTGCAGACTC
ATAAACTTCAGCACTGTGAGCGTAAACCAACTTATGCACTGCCGCGTCAATCTGACTCGCATCCTCCGCAGATATCTTGCCGAACTCAGGCTTTGAGCGC
ATCTCCTTCAGATACTTAATTACATGAAAGTGGCATATGAGAATGCGAACCTCCGGGAAATTAGCCTCGAGAACACGGATCTCGTTGAGATCTTTATCCA
CAACAATCACCCTGAGTAAGTTGATCCTGGTAGGGTGCGACCGCAAGAAGTGACCAAttgccttctccatgtgCCAGTCGCCGTTAGCTTCTAGAAGAGA
ATGTTGTACCACTGCCCCCTCACCAAACTCGTTCATTGTCATGAACGTGAGTAGTTGATAGTTGTATCTAAGACGAAAAACAATAATCCTGGTCAATCCT
GGTATTATCCTGTACAAGTCCTGGGTCAGAGCAAACACTCACCTGTTCGTTTTGTGACTACAGTCGATaagaagcagctcgctgAAGCGGCTGAATATAC
GACGCATGTGTGCAGACGCGATGGAAATAACTCCACTTTCTCCAGATTGAGTATCCGCAACAGAAGAGATATT