Description :
From Genome Similarity Track
Location :
Scaffold_1283:14- 1169
Sequence
1155 bases(100 bases per row)
CAACCGCCTCCTTCTCGGCGATGTGATACCGAATCTCCGCGTCGCTCAGCACGCGCCCCGTGAACCTCACAGGCTGGAGCACTCCATCATACTCCTGGCC
AAGGACCGCGCAGGCGGCCCAGCGGTTAGCATGCGGGATAATCACAAATGGCTTGGTCCGGTCGGGGTGTCGCAACAGGGGTGTCGACACGATCTTCCGT
TTCAAGATCTCGAATGCCTCCTTCGCCCTGGACAGATCCCGGCCGGACTTCACTTGATTCTCCGTGAGCTCATACAGGACTGCAGCCACAACCGGGAAGT
TCTCAATGAACTTGTGATAGTAGTTGAGGCTTCCGAGGAATGACTGAACTCCCTTCAGGGTATACGGGAACGGCAGATCCTGAATACCCTTCGCAATCTT
CGGAGTCGCGCCCATTCCTTCGGCACTGATCTCGTGGGAGAGATACGGGATACTCAACTTCCCGAACTCACTCTTGGGCAGGCTGACAGAGATGTTTCAA
TAGCGCAACCGGAATAGCAGCGCATTCAGGTCATCACACAACTGATCCCAGGTGGGCGATGTAGGAACTCCGTCCGAGGACAGGTCCCATCTGGGACGGC
ATCGGGATGTTGCGTTGAAACACAGTTATCCCCTCCACCAGGACGGGAATACTAGCTCCAGCCTTCTCCCGTTCGGATTCATCCCGGACGGACGGGTCCA
AACCGAGGAACTCGAGTACATCCGGGTCCACCTGCTCTTCTTCTTCCCGAGGGAGACGCACGAAACCCCAAAGGCAGTTGTTGATCACCGCCTGATATAC
GAGTGGGGCATTCTTGAGTCCAAATGGCATGCGTACCCACTGGAAGTGTCTGAATGGGCAGATGAACGCGGAGATTAGCTTCGCACGTTCCGTCATCCGG
ACCGCCCAGAATCCGCTCGCCCTGTCCAGACTCATGAACCACATAGCGGCTTCGAATCCAATCAGCAGATCATCGATCAGGGGCAACGGGTAGCTAGAAA
GCCGGATGAACCCATTAACCACCCGGTAGTCGATGCACATTCGGATGTCCACGCCATTCTTCTTGAGGCCGATCACAATCGGGGAAGCCCACGGCGACAG
CGACATCTCGATTAGACCTGTTTCCAGCAGCTTTTTCAGGAGCTCGTACACCTTC