Description :
From Genome Similarity Track
Location :
Scaffold_2066:14- 1136
Sequence
1122 bases(100 bases per row)
TCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACTTAGTTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTG
TTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTTGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTA
ATCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGC
GTAGTCTTACTCGTTTTCGTCTTCTTTTTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACC
GTTTCGCCTTCACTTTTCCTTATTTTGTTAGCGAATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTC
TTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTC
GATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACTATGAAATCCCGAGTCACCAAAAGATCCGGGCA
CGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACCTCCCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCC
GATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCT
TGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCT
TATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCCTTAAGTCGTACTTGCCGCCTCC
TGTGACGGGATCTTGAGAGTTG