Description :
From Genome Similarity Track
Location :
Scaffold_3322:14- 1131
Sequence
1117 bases(100 bases per row)
CGCTAGTAACTCCATATTCACTGGTTATTGTCAATCGAGGTGACAAATGGAAGGAAGCAGATGCGACCACCGCAAAACTGCAGGATAAACTTTCCGCAGC
CCAAACTCAGCAGCAACAGGTGATCCTGGAGCGCGATAGTGGCATATTGTAGCAAAATTTGGCACGTCGACGCCTGGCACTGGTGACAGCTGCCGTTTCG
GATCCACTTCCTCCCCTGTCGGGGCCCTCTCATGCTGCCAGCGTCTCTGCTCCTCTTCCGTCTGTAAGTGGGGCGGATCCGTCGGCTGCGAAACGTCCGC
GTAGTGCATCTCCCGCTCCTAGCACCGGGTCCTCCCGTCCCCATAAGCATGCTCGAGCTTCCCCAAAAGCCCAGCCCAAAACGATTTCAGCCTCTACAGC
GGCTTCGCGAGCGGGATCCACCTCTGTGGTAAAGTGCTTTCTCAGAAATAAGAGAATGGGCCTAACGCGGGGTCACTATCCCGAATCAATGACAATTTCA
AGTGATTAGAGAGGATTTGGGTTGGCTGGCACGGATGCAAGTTGCCGGTGGTGGATTAGCCATGACGAGCAGCGCCCCGTATGAAGTGACGATGGATCTG
GTATGAGCGACGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACTTGGATTCACCTAAATGGCTATGGGATATACTATACAAGAG
TGGATCGGGTGTGGATCCTATGAAGGAAGGATGGTAGGTGCCCTCGAAAGGTGGATCTAGTAGCCACGGCTAACGAGGAGTCAAGATCCACCGCGAGGTG
ACCCGGATCCCATGCTTTCGAGTTAGGATCCAAGGAGGGAGGATCCCGCCTTAAGGGACCTGGATCCAGGGTATAGGTATGATGGATGCAGTGGATCTAG
AACTTTCGTGGGACAATGGGGATCACAGACGGTGGCGAGATGAGGTTGGATGAGTGGAGAGCTCAGATCCACGACGAGTGTACACTTACAGTGAAGTGGA
TTCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCGTAATGATTACGCCATGGATCCGGTGGATCTGAAGATAATACAGCTGGGATGAT
GGGTCAAGGGAAGAAGG