Description :
From Genome Similarity Track
Location :
Scaffold_4067:14- 1118
Transcript NameFunction/comments
Phypl_g16153putative polyprotein

Sequence
1104 bases(100 bases per row)
ACAAATTCGTTGTACATTACAAACCCGGCAAGAATAACATCGCTGTCCCGCCGATCAGACTATGATCCGAGACGCGATATCGGTCATCAGGCTCTTGACg
ctgatgacgaagacgatgaatGCGCCTGCTGTGCTGAGCTTGGCATCAACACGACGATCTCGGTGCCGATGCTGCCGCTCCGCGAGCAGATCATTGAGTC
ATACGACAATGATTCGTTCTACGCCGACATCATCACACACCTTCGAGATCCCAGCGCGGTGTccttgaagaagttgacAGGCTCAACTCGCGATCACATC
AAGCGTTACCAGCTTGACGGTCCGCTCCTGACGTACACGATGGACAACTTTGACTCGCCGCGCGTCGTCATCCcagccgatgacgacgtctGGTTCACGA
ATACCATGACACCTCCGTCAGTGGTCATCTCGGCCGCGAGAAGACGTTCACTGCGCTATCCcgcgacttcttctggcCTCGCATGTACAAGTGGATCCGA
AAGTGGGTTCGATCCTGCGAGACTTGCCAACGCGTCAAGCCTTCGCCCTCGTCGCAGGCCCCGCTGCATCCGTTACCGATCGCTACGGATGCATGGCGCT
CTGTCAGCATGGACTTCATCTTCGGGCTGCCTCTGGACGACCAGGGCCGCACGGGTGTCCTGGTCCTAGTTGACCGTTTCAGCAAGATTGTCCATCTTGC
TCCAGTCGCCACTCAAGTCACCGCGGAGGACACGGCCAGGCTGTTCCTCGATCTGATATTCCGGCACCACGGTCTGCCGGAATCCATCGTGTCCGTCCGC
GACCCGCGCTTCACGTCAGCCTTCTGGGATCGactcttcgagctgcttgataCGCGCCTGCTGGTGTCGACTGCGGCCCATCCGGAAACGGGTGGGCAAA
CGGAGCGCGTCaaccgcgtgctggaagacgtcCTTCGCAGCTACGCCACGTCGTTCTCCTCGTGGAGTTCCTTCTTGCCGCTTGCCGAATTCGCTATCAA
CAATGCCGTCCACGTGTCAACCGGGTTGACGCCGTTCTTCGTAAACAACGCGCGGTACCCGCGCGTtccggcgctgctcgccctGGGGTCGATGATAGAG
AGCA