Description :
From Genome Similarity Track
Location :
scaffold_38:139971- 142773
Transcript NameFunction/comments
g12685.t1hypothetical protein

Sequence
2802 bases(100 bases per row)
GCGCTGATACAGAATGCTGCGGGAATACTAGCATCGCCAGGCGAATACATATAGTTGCGGAAGCCAAGTCGGAGGAGTTCATTCCACTAATGATGTGGGT
AGTCACCTCGGAGTTGGCTGCAACTATCGAACCTACATCAGTATTTGCCGAACCACACGCGAGAAGCACACTTAATATCTGGTTCCTGTAAAAGTGGGCG
TGGAGCGAATTGAAATCCACTCCCGTGAGAATCCCCGAGTCTGGCGAAGATAACGTAAACTTGGAACCAAAATACTGCAGTAGCCCAACGCACACTCGTT
TGAGAGATACGCTAGTGCCCAGCAAGCTAGGCCCTGTAGCCGTTGTAATCCCACTTGTGGCAACATAACCGGCATCATCAACTTGCAGAAACTGCAGGTT
TTCCAGCAAAAAGCGTATGAACGTGGATAGCACTGGATTCACACGATTGCTTGCTGGTGCTAGGTGGCGTTTAGCTCTTTCGCCAGCATCTTGAAGGGAT
CGATACATTAAAGCGCGAGCCATAGCCCAACCAGCAGCGTGTAACTTCACCAATGGAAGCTTGCGTTGTGGGTAGCCACGTTTGATCTGGAGCGGTGCAC
GCTTAATAGCCGTAGAATCAACGGCGTACTTGGAGTCGATCTCCTTCATTAGCGACTCAAATAGAGCATCTGAATTCACTAAGCAGCTATTTTCTGGAAG
ATCTTTTGCTTGGCTCGCGTCATCGGATATTCCATCAAGTTCACGGCTCTCACCAGAACGACCGGTGAGAATGTATGAGCTGTAGAACCCGGCCGCTATA
CGAACGACTTCATCGTTCGCGAGCGAATTAGAAGGTACGGGCAACGGGAGATCTGCAGAAGGAAGAGTTCTCGATCCTGCTCCAAGTTGACCCTTGTTGT
TACGCCCGAACACCATAACCCGTCCGTTTGACATTAGAATAAGCGTATGGTAGCACCCACATGACGCGACCTTGATTTTGGAGGACAAAGGTAGTGGTAC
ATACTGTGCACTATTCTTGTGGTCCTTGCTTCCAATTCCCAACTGTCCATAGTCATTCCGCCCCCAAGTTATGAGCTTGCCTTTTTCGCTGATCGTCACA
GTGTGATAGTATCCACAGCTCACCGCAACGATCTTTTCATCGCTTTCTCCAAGTGATGTTTTAGCCAGAGTCGGTACCTTCATGTTTCGTGCATGACCCA
GGCCAAGCTGTCCGTAGTCATTCTTTCCGAATGAGTATACCTCACCACCACTAGTAATTGCGACGGTATGATATAGTCCACACGCCACCTTGATGACCAT
TTGACTCGATAAGCCATCCACTAATTGCGGAGTGTGCTGGTGCTGGGTATGGTCAAGGCCCAATTGTCCACAGTCATTCATACCAAACATCAGCAATTCA
CCGTTGCTCGATACAATTGCACTATGATGATAACTGACGGCGGCAGTCGTAATATGATACTTTTCACGGACACTGTCGATCATGCGGGGCGTATGGCTCT
TTGAAATTGTAGAGCCAAGGCCTAATTGGCCCCTGTCGTTGTATCCCCATGAATACACAGCACCGTCTGCAGCCACAGCTAGCATGTGCTCACATCCATT
CGCTGCAGCGACCATATTAATAGCAATCCCGCTTAGTGCACGAACAGGAGTAGCGATGATAACCCTCTCCTCAAATGTTCCATTGCCGCATTGGCCACTC
TTGTTAAGTCCACACGTGTAAACTGCACCATCCTTCATGACTACAGCGAGGACTTCATTTCCTCCAGCAACATCACGAACAGCCTTTGCAGAAAAGAATG
GTACATGCTCCAGCTTGCTCGTTGAGTTACAGTGTCCTAAGCAAAGTTCTCCGTAGTTGTTTTGCCCACATGCAAACAATTCACAGTCATCAAAGCTGGC
CACACCCGACAGTCTTTCCGACGTACCAGTTTGTCCTGATGCGGTTACTCCTATATTTTCATCTCCGAGCGCAGCGTTTGGCGATTTGGATCGATTTAAT
ACGTCACCGAGTGTTGCGATTTTGTCATTCCATGACCTTCGTGGTGGGCAAAGAAGAGTGTTTTCCATCTGATCATCTTGAGATTCACCGGAAGTGTAGA
CGTAATAGGCTGAATCAAGATCCCCTCGGTTGTCGTCATAACATGCAGCGCACAGCTTGACACTGTCATCATCTCTCTGTCCATAGTATACCCCACACAG
CGGCATTCTCTTACACTCCTCGCAACAATAGGACCCTGTCGTGCTTTCGTTGTATGCAGGGCCATTGTCGCGGTCAAAAATGCCGCATAATCCAATGAAC
CCGATGTCGATGTTTGAACCAGACGCCGGGCAAACTGCCTTTACGAGAACATATCGACCAGTGACAGGGTAGGCCAACTGTCTTGAAATCTGAGCACAAT
TACCATCTAGTACGAAGAACGCAACAGGCATACGTTCATCTCGGGGGCAATGTCCACTGCTTGGGGGGAAAGGCAAGGCTGCAAAGTCTTCAGCGGTCAT
GTCGTCAAACTCCTGATAGCAAGTTAGATCAGGAGGACTACTAGTCACAAATACTACAGCACAACGCAGAGGGCTAGAGTAACCAGGTCCAGGCCCTCGA
ACGCTGATGTAGCTCACACACATAGGAGTGTCAACTTCATGCTTCAGCACCAGATTGACATTGGTTCCCTTCGCTGAGCTGTACACCGTCGTATCGTCCA
AAAGACAATTTCGAGAAGAATGAGAGCTACTAAACTCGCCACCGTCGCAGGAATGCACTTGTAGTTGCAAGCTCTTTCCTAGTTGCAGCTCATTTGATGA
AG