Description :
From Genome Similarity Track
Location :
Scaffold_239:13997- 18805
Transcript NameFunction/comments
Hyaar_Emoy2813066hypothetical protein

Sequence
4808 bases(100 bases per row)
CCATATAATTCCACGACCATTCGCGACAGTATAGACTGATGAATATCACTCTCATCGTTGCTGAAATTGAGCGACCACTCCGAGCGTTTTAGGTTTTGGG
TGTATCCAGCAACTTCTTTCGTGTATTGTGTTTTTTCTTTCTCCCATCTACTATCTACTATCACTTTTCAATAGTTAGCATCGCTAATTATGGACTGAAA
CAGATTCCTTTATGACAGGTTGTGAAACCTTAATAGGATTGAATGTTTATGTACTTGTGTATCCTTTCGGATGTGCAGACTTCCACGATGATAGGCAGTT
ATTCCGTTTGTAAGAACATTACAACTGATCCTTACTTTCTTTTATAAGGAGGATAAATTGGCTGTAAATTCGAGTACTCGTTTGTGGGAACATGATAAAT
TTTATAAAGGTTTTATAAAAGGAAAACAAAAAATCCCCAGATAATTGGAAAATAAAAAATGCCCCACGTCCTTGTATACTATAGTTACAGTGGTACACTT
ATACCGACATTGTGCTTGGATGTAGGGCTCAACCTAATATAAATACTCTCCCTACGCTGTGAGCTGATACGTTTGACTTTCTAAAACAGATGAGCCCTTG
CTTACGGTCACGTGGATATCCACCGTGACAGAGTAGACGTATACCATGCTCGCAAATCAACGCTACATTACGCCAATACATATTTGCAACGTGCAAAACG
GAGTAAACTAGGTGCCGTAGAGAAACTTAGGTCGAAACTAGCGGGTGTGTAGGTCCTTAACATTTACAAGCACCACTAATTACGACCAATTTACGTTAAA
AGGATACGAAAGGTAGTTTTATAGCACATCGAACAACGCAGCAGGTATTGTGGCACCAGGTATTACCGTTAGAGAGTCTCATGCCAAGTGCTGGCGGATA
CAGTCCGACATAATCTTGTTGAAGTCCGTATTGTACGTTTCAGTACGGAGTGTATCCATTTCTTTGTACTATGGTGCGTATATTACGGTTTTTTAACACC
CCTACCAAATCGAATGTTCTGTGTGTGTTTTCATTGCCTCTTGAGCTCTCTACGTCCAGCTTGTTGTCCTTAAGGTTAAGAAGCCATTAGCAGCACCACC
TCATCCCTGTAACAGCACTGAAATGTCGCCATCAGCATGAGTAAAGCCTTTTCGAATTAATAAATAAGAGTCAAACAGGTAGAATGGATTCGTGATAGTC
TATTAAATGTTTAACAAAGCTTAAGTAACTATAGCGAACGAACAGGAAACGTATTCCTATCACTCAACTAAACAACGACAACAGCATCACTGTAGTACCA
ACAAAACCACAAAACAGTAGTAACACCACGAACACTAACAGTAGTATCAATAACAACGACATCAGCAGCACCAACTTTAGCAGCAGCGGTATCAAAAGCG
ACAGGAACACACAATTACTTACATTAGTAACAACATCGGATACAGCCACAGCGGTAGCAGCAACAATGATACCAGCAACAACGACACTAGAAATAAAACA
GCAGCAACTGGAAAAAATAACAATAATATCAAATATAATATCAGAAAACAATACTAACGATAACAAAAACAATACCGTCAATTAAAACAATATCAGTACC
GATGGTCTGCATTACGGCCGCGGCCGACGATACGTAGACGCGTTTACATCTTATCTGTACCCCGCTGCGCCCGCAACTAGTGGCTGCGAGCATAGCACGC
CCGCGGCAGAACCCGCTACGCGGCACCGCAGGGCGGGGGGTTCATCACGGACATTGAATAGAAATTGTGAAATGGTATAATACGAAATTGTATGTGTACC
ACGTTAATTACAGTATACGAGGACGTGAAACATTTTTTATTCTCGTGATTAAATGGGGCATTTTTTATTTTCCCTTACTTTAATCTTAAAATGCGCGGTC
TTGGTAGCACTGTTCACCCACTCGCGCAAGAAGAGCAAGAAAAGAATATACCACCTACACCATACTTGATGTACACAACACCTGTACGAAAACTAATCAG
GCACATCCTCTGGCATCAGGTACACGACCGTAGTCTCCGTGGCAGCAGCTCATGATGCCCCCGCTCAGCACTAACGCATTTTTTGCCTTATCGAGTGCAA
TAAAATAGGTCCGTAGGTAGTGCGGGCGCAGCCTGAACAAATCTCTTCCGAGATGCTGAGTGACGTGAGCGATCACGACAGATGCATGGGTGGGTACTAT
CCTAGGTGCAGCTGTGCGCGCTAAAATTTATTGTACGTATGGAAGGTGTCATGCTGACAGAAAGCGATACGTAGAGTACATTGCTTGTGCCACTTGCTGC
AGTGAAAGTCGCTTAAAGACTGTGAGGCGTAGACTTCTCGTAGCATCGAGAGTGCACGGAACAGATCCATTATTTGCTAAATGCACCGGGCAAGCAAATG
ACGATCGACGAGCAACGAGAAAAAAGCTTTTTATTGCGCGCCTGAAGGGTGAAGCTATTAGTGACTGAGCGCAAGGTACGTGAATATACAGAATTTGATC
CAGTTCTATGGACTATATTACTTCTCCATCAAAGAGCGAACTACAAAGATTGCTCCTCCATCTGATATTAAGGCGCGTGTGAATCGGCAGCGGGACGACA
GTGTACACGTGTCGGCAAACGTTAGTCAGCAGAAGCACCGGTGTAACGCAAGAGCTGAACAAGGACGATAGCATAATAGCAAGAGCTTGATAAAGATTAA
GTCGTTTTTAGTGGCTTACATAGACACGATGAGACAAGCCGGTAATCGGTGTGCGCATGGCGCTCAGTTGGCTCACGCGGTAAAAGCATTCTTATTCTGG
AACAGGTATACTACATCTATGAAAGGAAGTCTTACAGGAAAAAAAGCTAAAAAATACCGCTTCCACCACGCGGTTTTGCTATTTCTACGATAGTAGAAAG
AGGCCTGGCTTTAGTACATTTTTGATAGGTATACTTATTTCAAGCTACACGTTTTGGCGATTTTCACTACACCATCTACCGCGCTAACCGTTACCAAAGA
AGTACACAACTGCTTAAGTAACAAAGACACTTACACCAATATGATCTTCGGCCCTAATGCTGCTGGTAGCCTCGTCAGACAATTAGATTTAATCACAAGT
CGATGCCATGAAGTGATCGGGTGTTGTCGAATCGATATAAACTTCAGATGCCAAGTGTCGTGATTTTGGCGCCCTGAGTCACTCGAGGACGTCTGCTTGT
GTTCAGCATAGCCGGAAGCAACACTATATCAAGCTATATGTGATGCATTCCACTAAACCATAGCTCAAGCCACTTCGCATCCTCGTTGTGGGTGATCTTC
GCCGGTGGTAAATCTTTATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAGCTATATGTGATGCATCACTAAACCATAGCTCAAGCACTTCGCATCTCGTGTGGGTGATCTCGCCGGTGGTAAATCTTTATGCAAATACGCT
TCAGAGCGGCGTTTGATAACTGCTCGTAGGATAAGCGGTTTCACATCTCGATAATGGTCTCTTGACTCTTGTGCGAGAGATTCATTCTGGAAGTACCAGA
GTGCCGATACCACGACACAGTCCACAATGAACGGCAGTATACTTCGTTCAGCTCCATTTAGTGCTTCAGTACGTATTTCACGCGTTAGCAGCATCAGCAA
AAGCGTCTGCCACTATGTTACTAAAGGGACCCGGATGCCTTGTCTTGTACAATCAAAAGTCATGAAGCCCCACATGATCATCTCACGCTTCGGCTCCAGA
AACTTTTACAGACTTAGCGCATTTCGGTAATCCAGCTGCGTTATCACAATTTGCTGGAATTGTATAGCTGCTGTAGATGATGGCAACTTGGCAAGTCCGT
GCACTAAACACGATACCGTTAAGATCATCCGCCAGTGACGAGCTGTCGTCAAAGCACGCTCAAAGACGCTGGACCGAAGTAACGCCATCGATATCGTTGC
ATTCAGCCAGCATGCCTACCCTATCGCGGCGAAACAGAGCAACAGAAGTGCTTTCACCTTGGAGTGGCTCTCACGTCAACTGCACCATGCTTGGTGTAAA
GAGCTGGCGACTGCACTCTATAGCCTTGGGTGAAACGCATCAGCAAGAAATAGTCTCTAACCAATGCACAACTTCGACAAGTTGCCTTTCCAGCAGAAAC
ACCCACCTTCATCGGTGAAAGCGAAGGTGAAGTCGAGTGCACGAGAAAGAGGAGCAACTCACTGCTACGAGTGGATGCAAAGATTCTGCCACAGCAAGCT
CATGAGGTCCGCGGACCCCAATGTCTTTCACGCACAGGTAGATATAGACGTTTGAAGCCACCCGATAAAGCTCACAAGGTAAAAGCAGGCTCATTTGCAC
CGAGCTTA