Description :
From Genome Similarity Track
Location :
Scaffold_664:13996- 15013
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_664-snap-gene-0.7Cytochrome c peroxidase, mitochondrial

Sequence
1017 bases(100 bases per row)
GGCTTCGCCATGACCGACCTCGTGAGCGCGCGCGAGAAGAAGCCGGACCTCGAGCAGATCAAGAAGGAGATCGTCGACATCTACGACGCCAACAACTACA
TGGGTCCGACCTTCGTGCGCCTCGCGTGGCACTCGTCGGGCTCGTTCAGCAAGCACGATGGCGGCTCAGGCGGATCCACGGGCGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCCGCTTCTCGCCCGAGATCAACCACGGCGGCAACGCTGGCCTCCACCTGGCGGTCAAAGCGCTCGAGAAGGTCAAG
AAGAACCACCCGGAGATCACGTACGCCGACCTGTACATCCTCGCCGGTGTGGCCATCATTGAAGAGATGGGCGGCCCGTCGGTGCCGTTCCGTCTCGGCC
GTCCTGATGCCCTGAGCGGCGAGGAGTGCACCCCAGACGGCCGTCTCCCAGACGCCGACAAGGGCACGCAGCCAAAGACCATCAACCACGTGCGTGACGT
GTTCTACCGCATGGGCTTCAACGACCGCGAGATCGTCGCGCTCTGCGGTGCGCATGCCATCGGTCGCTGCTACCCAGACCGCAGTGGCTACAGCGGCCCG
TGGACGAACGCAGAGTGGACGTGGTCGAACGAGTACTTCCGTCAGCTCATTGAGAACAAGTGGACCGTGAAGAAGTGGAACGGCCCGATGCAGTTCGAGG
ACCCGACCGGCGAGCTCATGATGCTCCCGGCGGACATGGCGATGATCGAGGATCCCGAGTTCAAGAAGTACGTGGAGCTCTACGCCAAGGACGAGGACCT
CTGGTTCGCCGACTTCTCCAAGGCGTTTGTCAAGCTCACGGAGAACGGTGTCAAGTTCCCAGAGAACACTGGCTGGCGCAAGTACATCTTCTTCGGCCCA
CGCGGCGAATAAGCATG