Description :
From Genome Similarity Track
Location :
Scaffold_992:13992- 15243
Sequence
1251 bases(100 bases per row)
ATCTTCACTAAActctcgaagaagttggGAAACACGCAAGTTGTTTTTCTCCGCTGAGTAGGTTTCCCGCCGCATTTCGAGATGAGATTATCAACATTCT
TCTGCAAGAATGGTTGCCAGGATAAATATTTCAGGTAACGCAATATTTCATTCTTCCTCGAACCTCATACACATCACATCGCACCAATTAGCACTCATTT
ATCCGTAGTGTAGGCACACACAGTCATTATCTTACACCATTGTTTCGACAATGCGTCGCGTGGCAAGGGAGGCAATCTGACGGGCTTCGGATTATAAAAA
AAACACGTATTCATTAACGTCATGGCTGTGCCCCGCGTAATTCAACGTTACACGAACCTTTAAAACGTCATCCTCGGTTTTGAAGCGACACACCTCCAGA
TTCCGCGGGGCACCCGATGGAACAGAAGTTGTGGTTCGTCCTCGTTTCTTTTCCTGTAGGCTTGAACTTCCATCCATGAATGCAGATGTAATACTTTGCG
TAGAAGCCAAGCACTTCACCCCTTAGCTCCACAGCAGTTCAACGTCAAGATGCCTGAGTTGTGCGAGATTTGTTTCGATCCTTGTACGATATCGTAGACC
AAATATTGTATAGTTGATGGGTCTCTTCTTGGTATCTGCCAtcgtatacatgtagttagaTTTTAATGGATAttcatttaaaaaaatacaATCAAATAAC
GCATATCCATACTCACTATTCAATTAAATTCATCCCACGAAGAAAACACACCGTCAAATGGCGTAAAATCCCGCACAACACGTGCCGCTTTGTCACCTTT
GCTGTCGCCCACGTGCTAGCGAGCACGCAGGAAGTGGGGAGAAgtgagggggggggggggggtagtCTGCTGACCGCAAAATTTTTTTATAGTAAAGACA
TAGTTTAGTATCACAAACCAGATTAGTAACCTTGTCATTTTCACCCAGTGAAGAGCTTCCTTCGAGTTTGACAGAATACCGTTGCCTTAAAATCACTATG
TACAAAATCCGCACAAGCTGATGGCTAGAAGCATTTTAATGGCTGTGGTGAAGCTTTGGCGGCAAAACAGTGGGCTTGTAGCGCCATTTTCGATTTCGAA
GCAAAAATTTAAGATGGTctcaacaagaagcaattATTCCGACACTAAGCTGCAAACCGTTGTTCAGCGTCTGATTAATAGGGAAGGACATCGTCCAGGG
GCCGACTGAACCTGGATTCCCTACAGTACGCTTTGCAAAAAGTCAAGGAAG