Description :
From Genome Similarity Track
Location :
Scaffold_1078:1399- 2529
Sequence
1130 bases(100 bases per row)
CAACGCGGGGTCTATTCGAATAGTCGGGAAACCCTTGTGTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGC
AGTAGCTGCGCGAAGGCAACACCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAG
ACTTCGACTTATGCACCCACGCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAG
CGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCAGCATCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGCTCTTAG
ATTAGCGTAGTGCTCAACGCTTATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGTCTGAGGATGGGTGAATGTGAAACACTCG
TCTTCAACTTTTCGAAGGAACGAGTGCCACAGAAAGGCCACCTTCATCTACAAAGTCTTCATCCTTGAGCTGATACAGCGCCGCACCGTAGACCGCGAAG
TCATGATAAAGCGGTTGTAGTAATTAACCACTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTAGAAACGCAAGCTCTGTGATGGCCGCAAGCTTCTT
GGCGTCAGCCCTGATACTTCTGCAAATTTATGCGACAGAAAGTCTACCTTGGGTTGGCAGAAGATGCGCTTGGTGAAACTAATGCTGATCCGACACTGTG
CAAATCTTGCCAGCAATCGGTCCAGCGCCGCCAGGGAGCTGTCGAAATCCTCGTCACCGAAGCAAATATCATCCACAAACGACCGTCGACCAAACACGGG
TACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTTTCTACCGGTGCTTCGCGG
TCTGCCGCGAGCTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAACC
AACCTCCTTTAGGCTGAACGAACCCCCAGA