Description :
From Genome Similarity Track
Location :
Scaffold_795:13989- 15236
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_795-abinit-gene-0.16Serine/threonine-protein phosphatase 6 regulatory subunit

Sequence
1247 bases(100 bases per row)
TAAAGTCGTCCTTCTCAAGCAGGTCGTTCAGGGGACTGCTCACATGCGTTATCAACATACACACATACACACACCCATCGCCATCAGCCCATGCTCGTCC
ATCTATCTATCGCTTGCATGGTGCTGCGTGCCCCACTTTTCATATTTATATTATAGCGAGCAAGCAAGCAAGTCCGCCCCCGCATTCGCATTCAGACGCA
CCTGGAGATGTTGAAGAGCGACGATCCCTTGCCCCAGACGCTCGACTCGTCCATGGAAAACAGCGACATCTCTGTGTGAGAAGTGGTGGCGTGGCTTGGC
TCTCTCTCTATAGACTATAGACGACTCGCGCGCGCCGTTCTCTCTCTCTTGAAGCGTTCTCGCGTGGCGCTCTTTTCGGGTCTGGGGGTTGGTTATTCAG
CCAAAAAAGCCCAAGGGAAACAAACGTGAAAGAAAGCGCGAGTGTTTTGTGGGGCGGAAAGCGGACCGCCGAGTCAAAAAGCCAAGAAAGCGCGCGCTTC
TCACAAAACAGGTGGGTTCGTGGGTTTAGGATTCGTGAAATCAGCAGACCCACCCACCCACCAGCCCATCCAGCTAAAAATAGCACGATGCAGTGTAAAA
AAGAATTAACCGTCCGCCCCATGTTTTTGACCTTACGCTGGATAATACGCCAGGAGGTCACCCACAAATCAATACAATCCGCAACATTGGGAAAAGCAAA
GGAAGAACGAAGAGAGGAGGGAAAAATGAGATGAGGACTCGACGCATCCACGTGCGGAAGCAATTGCGTTTTTGCTGTGTGGCTGTGATGCCCTCGTGTC
ACTCGCTCGCTGCCCAAAGTGATGGATGGCTTCATTCATCCATCCAGCGATTCATCGCGTCATGCGGCCCTGCCTATTCCGTTTGTTCCTTTCGGAACTT
TGCCAACTTCATTCGCGACTGACACGCGCGACACCCCGCGAAACAGTCTCGAAAGAAACAAAGAGCAGCCATTTCCTGTATCCACGTGATAATCAGCCAT
TAATGTACACCTCGACTGCTTTGCTTTGAGCCACTAGTCTCTGCTACATGTTGTCTGCGTATGCACTATTTGTTTGCATTATTGCTTGCTCCTGATCCAT
CCATCGCCACGCTTCGCATCCAGCGTGGCTGCATCCAAATCAGTCCGTCCAACCTCGCTTTACATTCGCCGCCACCCTCGCTCGTTGCAATTTGGCCTTC
AAGTTGCTTCAACTTTCTCTTTCACCCCTTTTCAACCAATCATTTGT