Description :
From Genome Similarity Track
Location :
Scaffold_9:1398881- 1402147
Sequence
3266 bases(100 bases per row)
ACCTTGGTGTAAGGTACACCAATGGCTACCTACATTTGGGACCACCACGACGGGTGGTTCATACACATTTAGGATTCCTATAGGCTGAAAGCAGCATCTA
TTAGCCAATGAGCGACTTGCATGTTAGCGAAATCCTGCCAACCAGCTGTTGGCAGATTCCTAGTTTAGAATATTACATTTTGGGGAAGTCAAAGCATAAA
TCACAAATAACATTTCTCATCTTTCCAAAACCCGAGTCTTTATCTTGTTTAAAGTCTACTCGTGGATCTCGAGTATACTTAACTCAACTAAAAGAAACCT
ATGCTTCCTCTAACACGTGCGCACACGTGTAAGCCGTAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGTACTTTGTAGTCCGTCCAACAACCGAG
TACCTGAATGTTCGTACGGAGCTGTACCAACGAGGACCCGAGAACCTATTCATGAGAGCGGAGGTGCCCATGAAAAGCTCCACTACGTCTGCAAGTCAGT
TGCACGCGCTGACTGCCTCCACCTGTCGGGCCCAGAGTGGGAGGCACTCCAAAGACTGTCAACAGTCATTGGAGAAGCGGCTGTAGCTGCAATGCTGCGC
ACACTATTGCCGATGGAGGAACACGGTGTTGCTCAGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTATCACGGTGGCGTCGGGGACGACAC
CGTGCGAGCAATCGTTGAAGCTAAATGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATCGCGGC
TCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCAAGTCCTGGCGGACGAGCGAGAAGTTAAGCGTATGAACGCCGACTCTCTGATCCT
ACGTGCTTCAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGACAAGCATTTGAGCCCCCGCAAAATGAATTCCGGTCGAGGGCGAAGTTACTCGACCTGC
AGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTATTTGGTCTCGAACATTGTGACCAATCCGATAGACGAGGCGACTAAGGTCGTCAC
GTTCATGAAATGACTTAGAGATGGGCCTGTGAAGACCAATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTTCAATGCATGAGGAG
TTTAGCCTGCGACAGGCTAAGCTGCATGCGAATGCGCCGAGGCTGCAACCGCCTCCGGTCGCGATAGCGGGAGGTCCGGAACCAATGGACCTCTCGAATG
CAACGGCTGCTGATTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGAGAGTGCACGGCACCCGTGCT
CCGAGATGGTGGTTGACGCGGCGATGCCCGGCATCGCCGCGGACAAACAAAAAACGCTGGAACCCAGTAGGTGCGGGGCGCCCTACTGGTGAAGCAGTCA
CGCGTGTTCAACTCGGACATGCGACACTGAGGACCGCAGCCACCAGTGAGGACCATTCTCACTGCAAAATGCATGATGACAAACTGAACCTTGTCATCTT
GGACGTGTCTTCGAAGAGAGAGAGAGCAACTCTCTTCGTGCTTTGGTAGATTCGGGCGCGTCGATGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTG
ACTTCGAGGAGGTAATTATACCTCGAAGTATGTTAGACGTTCGATTGGCAACGGGTGCCATCGTTAAAACCGAGAAGCGCATGGTACGCGTGCGCTTCAT
GTACGAACATCGAGTGTTTGTCGAACGCTTCATCGTCCTGGGCCTGGACGATAAGTTTGACATTGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCG
GTAATAGACTGGGAGAAGCGCACTCTTGTGGGCTTCGGTCGCGATAGCGGAACAGAGAGCGATGGCCCTGTTGCCGCAACGCACGCACCGACAGGTGCGT
GCGTTGCACTCTCCAGTCAAGCCAGTCCCTAATGGCGTTGTCCCGGAGCGCTCTGGGGGCGCTAACACGCGCGCAAGAGCAGCAAGCGTCGGCACCACCG
CCGACGGCTGAAGAAGAAAATGTGTCGATTTCGGAGATCGACACAAACATTTCAGTGAATCAGTCTCCAGCCCCAAGGCCGCGGATGACGCGTATTTGTC
ACTAATGTCAGTCCCCGAGACTGACACAAATCTGATTTTGGGAGTGTCTCCGGCCTCAAAAGGCGCGGATGACGCAGGCGAGTCACACGCCGCAGCCGTG
AAGGCTGACGCGAATCTGATTGGATCAGATCTGGACAATACTAAGAGCCAAAGTGACGTAGCGCCGTCGACTCCGGGAGTCGATGGTTTGATTTGTCGGC
TCTGGGAGCCGACGCACCTTCCGTAATGGGGGTTTCCGCCAATGGTTGGCGTCGAGGTATTAAAATCGCGTCGGTTCCGGGAACCGACGCTGTGAAAGGA
AATTTCGTTATTGGCCGAGCCCTTTGTAACGAAAGGCTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTCCGGGAGTCGACGCTGCAGGC
GGTGCGGGCGGTTGCAAACGTTCCGCACCGGAAAAACTTGCACACTGTCGTGCAGCTGGACTGCACGACACAAGGAGCGCTTTGAAGAGCACAGCTGGGA
CTCGTTGAAGACGAGTCCCTACTACAAGATCTTACGGGTGTACGCGGACGTGCTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAG
CACGAGATTGATCTCGTGCCAGGGACGAAGTACTGTGTCACGCGACAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTC
GTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGTAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTA
CAACAAGTTGAACGATGCGACGATACCGGCACAGACACCGATACCGCGAAAAGATGTTATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGATCTT
GATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGAAATCCCTCTCACGGCCGTGAGCACGCCGAGCGGCATGCGCTGGGAGTGGCTAGTAA
TGCCGCAGGGTCTGAAGAACGCCCCTGGGACCTTCAACAGGTGCGTGAGCACGGGTATCTCGCTCG