Description :
From Genome Similarity Track
Location :
contig_200:13984- 16886
Sequence
2902 bases(100 bases per row)
AATTCTGATTGTGCCTCTGCGGTTCGCAGAGGTTGCTGCTCGTCGCCGTTGAGACCATCCCGTTGACGCCGCGTTCTCGCCGTTTCCCAGTTTTCTTTTC
TTTCAGTTTTCTTTGCTCGCACTCACGGAAGCGTGAGTGCAACCTTAAGAGGGGGGTGATGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTAT
ATAGGTAGATCTACAAAGTAGAGACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCATCCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTCGAC
CAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCCCCGGTCCCAATAATAAACCAGAGTTGATTTTACCCTAGACTAAA
CACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTGGCCCGTTACATATCATCCAGATG
AACTCCAATTTTTTTCGCGAGTTCGATCAAGATCATGATCGGATGTGATCGGCTTGATAAGGCTGCTCATAATATTTAATTTCGTGCAAACTATATTAGG
AAACATATACAATCAACGATGAGTGAAACTCAACTATCCGACCAATATTTGTACCAGAGCTCGCTCAAGAGCGATCCGGAGATCAAGGTATCTTCTGACA
AGCGAGTACCGTTTGTAATCGATCTTAATCAGGGATCGTATCAGAATGGTGTTATTACTATCGATGCAACTGCTCAGCTTAACGGATCCGAAGGATTTGC
TTGCCTTCGCGATGCGTACATCATGCTCCCATACAAGGTATCAATGAAGAATGGTGCTACTGCTCAGACTGCTGCTGCTAATCGTTTCTGCGCTACTCTA
AAGTGTGGCAACTGGAATGTCATTGATAGCATGTCTCTTGAACTAAATGGTAAGACCATTGTTTCTATGGCTGACTACAAGCTCTTTTGGAACAATGTCC
GCGCGCAGACAAGCTACAGCACACAGTACGTTGAGAAGCATGGAGCAGAGTCGTTCCTTTACTCGGATGCTGCTCAGTCCGCTTTGTACAGTTCTGGTAC
CAGCTCGACTACTGGAGATGGATACTCAAACAATACTGCATTCTCGTCTTCGTTTGCCACCACTGGCCCTTCGGGTGGTGCATCCATTCCAAACGATGGC
TTTGTTCGCCGACTTCTGTCGAACCCTCCTAATGCCGGTTCTGATTTCTCTACGTCGTGGCCGTCGGTAGGTGGAGCTGCCGCGTCTACCACTATCTCGA
ATCAGACTGCTCGTGGTACCTTCGTAGCTGGTGCTACTACCGCTAACGCCATCATGGGAACGTGGAACTATATGCTTAAGATTAAGCTAACTGACCTCCA
TCCGGTTTTCAAGGAGCTCGACTTGATGGCTAACCCCCAGATCCGTCTCCGTTTCCGTGTCAACCAGGGTACTTCGTCTGTTGCTGTAGATGTATGTCGC
TAACCAGTACTACTCTCGCGAGTGGCAACACCTGTCCGGTAATGGTTTCAGCTTCTTCGACTGGTAATCCTATGGCTGGTGTTCTTGCTGCTTCTGCTCC
ATTCAGCATTTCTTGGGGTGCTGTAGTCAATGCACTTGAACCGACCATCGATGGTACTTACATGCCATTTACTACTTCTCGTATGTACCGTTCGTTCATC
TCGAGAACCCTCAGGCAATTATTTCTAAGCCTGTTAAGAAGGTTCGATACAATGATTGTTATGCACAGTGGTTTTACCAACGCGCTGGTACTGGTAAGCA
GTCGACTCAGCTTAATGCTGCATTTGATCTCCAGCTATCGGCGTCTGTTAAGAATGCTAAGTATATTATCCTCCTTCCATTTGCTGAGCAGACGGGTAGT
TTTGCTTCTGCTGCTGTACAGGAGTTCCAGAGTCCGTTTGATTCGGCTCCTTGGACTCTTCACCCCAGTTCGAGCATTCGCAACTTTAACGTTCGTATTG
GTTCTCAGCAGACGTTTGACATCAGCCACGACTATGACTTCCACCACTTCACTAACGAAATCGCTAAGATTGCTTCGATTAACGGTGATCTGACTCCTGA
GCTGGTGAATGGTCTTCTTGACTATCAGACGTGGTCGCTAACTAACGTGTTCTCATTGCTGATGTTAGCCGCCTGACGGAACGTGATGTACCCCAGGCTA
TTCAGGTAAGCGGTGTTAATGCTGGTTGCCAAGGTACCAACATGCTTGTGTTGGTTGTGAGTGAACAAGAGCTTTCCTACGATCGTCTAACGGGTGAGGT
ATTGGATTTTACCACTGCTTAGTTTTGGATTGAAAAAAAATACCTTTTTTTTAATTAAGCTCTAAAGCCTCTACAAGCTTAGGACATTTCTCAATTACGA
ATAGGTTCTTACGAAGCCAATCAATATAATTAGAATCGGTGCGACTAATTTGCTTTAGCGTCTTCCCCTTGTACTTGCCCCAACTCATCATATACGAATT
ATCATTGCTTAGAAACTTGGAGTGAAGGAAAATCTTGATATCCCAGTAATATTGAGACTGGGTTGGTTGTGCATCCATCGACAATAACCGGGATCAGAAG
AATAAACTTCTTCGATCGGCGCGCCCTTGTATTTTCCAAAAGTTAGTTCGAACGTCATGTTATCAGTTGGTGGTATCTATATACATACCCCTTTAATTTT
TTAGGGAAAAAAAATAATTATGTAGATTGCTTACCATTTACTAAAATCCGGACCCCACCACTCAAGATCTTGCGGATGTGGCATTGTCTTTATCCACTTC
GAATGCTTTTCTTTATTACAGTGTTTTGCAAAGTTCCATCTCTCCATTGATGATCCACACAAGCAAGTGATTCTTTCATTCATCGGTGCTGAAATAATTG
TT