Description :
From Genome Similarity Track
Location :
Scaffold_243:13982- 15538
Sequence
1556 bases(100 bases per row)
AAAGCTACAACAGGTTTCGTTAGTCACCCATCTTAACAATACTGTCTATATAAAAAGTGCTGATGATGATTGATGCACCTTGATAGAAAGGACAAGAGCA
GCATAAGTACCCGTCGACTTGAGTTCTGGCATATCATTGCCGGCATTTATCGTACTCATGTACGAATGGTTCACCTCCTCTTCTTCTGTCGCTAGTGCTT
ACCCGTTCGATGCTTCCGTAGCGTCCGGATGTTCCTCGAGTGAACGAACCACCTCGACGTAAAATTTATAAGTGGCCTTCATACCAATCATCTATGCTGT
TTGTTTCTTGCCGAGTCGAATCAAAAACAGGTCGATAGAAATACTAATCTAAAAAATACGTTGCATTCGTGTGGCATATTTGCACAAAAGAACGATGATA
GCGCTGCTGGAGGAACTGTACATGGTCAAGGTGCTGCATCAGCAGTAGGGAGTATGTCTGTCCACACAACAATGGAAGTGGAAACCACAAGCACATGCCG
AAGGTTGTTGACGCGATCGTCATGTCATTTACGCAGTTCGCGCGCGAGATTGACGGTGAAGGTGCGGGCCGTGATCGGTGTGTACGTCGTGCATGTATTC
GCTCTCTAATTGTAAGCTGTATGTTTTAACGGTCTAGAGGTAGTCCAAGTGCACTTTGACCCGAGTCATACCGACAAAAAGGATCGACAGAGCAGCAGCA
GCTTTATCCCAGTAAATAAGGAATAACAGGTTTTACAGTACAGAAGTCGTACTGACCTGCTAATCTCGTCACATGCGGAACTCGTCTGCGGTCTTCATGA
TTTTGCTCCAGAACGATACCATTCAGGTTGTACTGTTCCACGAACGAACTGGTTAGTCTGCAAGTAAAGCGCTTAAAGCGTTTCTACTGCGATTTCTGCA
GCAGTTAGGAGAAGCGCTTAAGCAAGAGCTTTCTCAATTACAGCCGCAGTTACAGGCGAGTGCGACGCCCATGCCGGAAAAAGTTGGTGTCGATACTGGA
ACAACAACATGGACACTAAGCTGCGTCTCTACTTTTTGCATCGTTTTTGTGGCCTTCTTGTATGCACCCTATAGCTCGAAGCCGTTAAGCTCCGTTTCGG
AGATACGATGCTGAGCTTGATAGTCAATTGCTGCTGCAATCCAGTGGCGACCTCGGTATAGAATGAGCTGCTGGTGCGATACACTGGGGTCGTATGTTAT
ATAGAATTAATATATATATCGAGGCTATTTGAAACCGAGATGCAAGCTTTCCCTGCAGCAAACTCGAACGATAAAGCACTGCTGTGAGTAATTTGGAAGT
ATCTCAATTATCGCTATAAATACTGCGGACTCGAAATCTGCCTGCTTCATGAGTATGTAAGATTTATCGTTGTCATGATTTGGCCCACACATCTTGAATA
GTTCCTGTTGCTGCTGCTGCTAGTCCAACGTACTTGTTCTTCGTCGATCACCGAGGCCAACAGGCTTGACTCCGAATACGAAACCCCATATATCCAATTG
GACACGACAAAACTGCTGCGACGTAGTTAATGGAGATAAATCGAACGTTTTGCACG