Description :
From Genome Similarity Track
Location :
Scaffold_15:139818- 141598
Transcript NameFunction/comments
Sapdi_VS20SDRG_05629hypothetical protein

Sequence
1780 bases(100 bases per row)
CTGCTGAAAGTTGAAGACGGTGCCCGAGCCGCCCGAGCCAAACGTGAATTGGTGGGCGTTGGCTGCAGGAGCAGTCTCAACGTCCTCCTCTTCGTCGACA
CCGCCAAAGTACGTCTCGATGATCGAGAGCGCCTTCTCGTAAATGTCTACAGGGAGACATCAGACGCGCACCATGGACGCACTAAGATCTACCATTCTCG
TGGTGGTACTGCAGGTTTTGGATCTTGGTGACGCCGTCCTGCTCTTCGATTGCGAGCGCCATCGGGTTCTCCACTTCGCCGTTGAGCTCGGCGTGCTGGT
GGCCGACGCGCAGAATGTTCTCGAGCGCGTCCAAGCAGACGCAAATGATCTTGCTGTCGGTCACATCAAGCAGCGCCACAAGCGGCGGGATGCAGCCTAT
TCATGCCACAGTCGCATTGACGTCACGCATCCACGGCATGAAGGGCGTACCTTGCTGGACGAGGTAGACGAGCTGGTCGGGGGTGCCGCCCGACGTCGCG
TTCGAGACGGCCCACGCGGCTTCCTTGCGCACCTCAAACTCGCCGTTTGCGAGCAAGTTCATGAGCGGCGGGACGACCTGCGAGTCAATGATGGCCTGGA
TCTGATCCTTGCTGCCGGCCGTAATGTTACTGATGGTCCAGCACGCTTCCTTGCGGATGCCCTTCTTGGCCGAGTTCAGGAGCGGAAGGAGGCGCACGAG
CGCGCCCGAGCGGATGACGAGGTCCGTCTGCATGTCGTCGCCCGTGACAATGTTGCCGATCGTACGGAGCGCCGGCGTCTGCACCGACGTGTTGGGGTGC
AAAAGGAGCTCAATGAGGCGCGGGACGACGTTGGCTTCAAGGACCGCTTGGATCTTGTGGTTCTCGCCGTCCGAGAGGTACGAGAGCGCCCAGCACGCGT
CCGTGAGCACGTCTTCGTCTTGCGAGTAGATGAGCTGCGCGAGGCTCGGGAGCGCGGGCTTGACAAATTCAAAGTGGGGCTGCGGCTTGCCGCGGCAAAA
GTTGCTCAACGTCCATGTCGCGTTGCGGAGCATGCTCTGCTTGGCGTTCTCCGTGAGCTGCTGGATGAGCGGCATGAGCGCGCCCGACTGCAAGACAAGG
TCGCGGCACGTCGGCGAGTCGCCCGAGATGTTGCCAAGCGCCCAGACGGCCTGCTCGCGCACTTCGTCGTTGGGCGACATGAGGAGGCGGACAAAGCGCT
CGACCGCGCCGTTCTCAATCACAATGCGCGTGTGCTCCGACGTGCCCGACGCAATGTTTGTGAGCGCCCACGCCGCCTCAAACTGGAGCTTCGGGTACTG
CTCGTAGCTCAAGAAGGACGTAAAGAGCGGGACAACGTTCATGTTGATGACCTCCTGGATCGGCGGGTTGTTTTCTACTCCATGTGCATCAATATCGACC
TGCAGATATGGATGCTGTCGTACCAATCGAGAGGAGCTTGCGGAACTTGGTGACGGCCGCGAGCTGCACCTCGACGTCCGACGAATGCACCTGCTCGACC
ATCTCGGGCAGCTGCTGGAGCTACAAAGAGGAGTGCATGAGCGCCTCGCTTCGTTCAGAGAATGTCTCGTACGTAGGCCTGGGCACCCGGGGTCCCGCCG
GTCATGGCCGTCTCGTCGGCCGTCGTCGCGCCCATGACCATGCGGCGGCGCTGGTTGACCTGCTCATCCTTCTTCGTCTTGCGGATCATGACCGTGGTCT
CTTCCCGGCGGCGACGGGTCTCATCCGTGTCGATACCCTTCTTGTAGTTCTTATGGCGGTCTCCCGTGGGGCGTTGCATG