Description :
From Genome Similarity Track
Location :
Scaffold_36:139802- 141039
Sequence
1237 bases(100 bases per row)
CGTTGGNNNNNNNNNNATCAAGCTTTGCTTGATACCTTCGAAAGAGCGCTGGCAATCAGCACTCCATGCCCACTTCTCGTTATTTTTCAATAAACGAGAG
AGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGGCCAAGGGGCTTTCGAAGTCCTTTTATGTCGGTAGGCACCGGCC
AGTCAGTGATCACCTTGATCTTTTCTGGATCGGGCCGGAAGCCGTGCTTACCCGCGATGCATTCAAGAAGTGGTACTTCGCTTGCAGCAAATATACACCT
TTTGAGGTTGGCGTAAACTTGTGCTCACGCATCAGTGTAAGAAATTTCCTGACGCGGAGTCGGTGGACTTCCAAATCCGTCTGTCCATCCATAGCCTGGC
TGTGGACGAACACGTCATCGAAATAGCTGGGTGCGAATTCTCGCACAGATCTCAACAGATTCGTAACACATCTGTTGAACGTAGCAGGTGCATTACTCAG
CCCTTGTGGTATACCTAGCCACTCCCAGAGCATACCGCTCGGGGTGCTCGCTGCTGTATAAGGAATGTCCTTTCACGCATAAGGATCTGATAGAACCCGT
CCATCGGATCCATCGATGAAAATATGGTACTCCTTGACATACCATCTATGATGACATCCTTTCTTGGTATCGGTGTTTGAGCCGGTACAGTGGCAGCATT
CAACTTGTTGAAGGCATGTACTATCTGCCATCCCACTGTGGCCTTTCGGACACAGAAGGTCGGAGATCTATGTGGGGAAGTAGATTCCCTAACATGGCCC
GCTGTCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTCATGAAGCAATGGCCATTGCTTCATGACATAGTACTTTGACCCCGGTTTCAGGT
CTATCTCGTGACGAGTACCCTTATCCTTGGGTAACTCGCACGGCACTGTTTCTGGGAACCTATCCCTGAATTCCGTCAAATCATCGTAGAGAGGATTTGT
CTTGAGCGATTCCCACAATTGGGATGTCTTCTCATCAAGAACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTCCGTTCTCAGCGAATACCATTGCC
GACCGAATATCGGTTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGCAAGAACCTGTTCTGTTCGAGCG
TGGGTAATTGAATGATCTCCGAAGTTGTCTTCGGAGG