Description :
From Genome Similarity Track
Location :
Scaffold_177:1398- 3306
Transcript NameFunction/comments
Phyag_g3108hypothetical protein

Sequence
1908 bases(100 bases per row)
ATGAACGACCCGTTCTTCGACGAGGTACGCGCCCCCCACCGCCATATCTTCATAGCCTCTGCTTCCTCTATCTCTCATCTCCACGTACATGTTTTTTCCG
CTCTAAAACGCCGCAGGATGACGGCGAATTCGACGATTTGTATGGGAATCCCCGCCCTTCCGCGTCCGCCCCCGCTACGAAGCAGATACCCCGTAATACA
GAGACTCCTTCGGCTCAGCCAGTGACTCCAGGCGGTCGTCTATCTATCCGCAGCcctgcagcgtccagcagcgtcgtctccCGCTCCTACGTACGCGATA
GAGCAGGATCTACAGCCAGTAACATAACGGACCTGGCAGCTTCAGGAAAGCAGGACACAAGACGCAAAAAGCACGGGAAAATGCGTCGCAAAGGCAGCCA
GGAGCTGTTTGACGTGCAGTGGGAGtcggacaagaagacgaccaaATGCGGACTCTGCAGGTCGGACTTCTCGCTCGTGAGACGCAAACATCATTGTCGT
CATTGCGGACGCCTCGTGTGCTCGGACTGCTCGGTGTTTCTGTACTTTGAGTTCTCTCAACGCAAACACAGAGTGTGCGTGATGTGTAATAATCAGTTAC
TGAAGGAGCAAGACGCTTATGACCGCGAGACGCTCGCTGGTAGGAGTCAGGTGAATTTGTTTGACAACTTGAGTGAGGATGGAAAGCCGCCGTCGGTGAC
ACCGGCGTCTACGACTGGTGATGCGGAGTGTAATAATGGTGTTGATGAGAAGGCAAATATGAAACAGGAAAAGAAGGAACGCAAAGACCGGAAGAAAAGG
GAGAAGGGGGAGAAAATGAATGAGCAGAAGACCGAACAGGTTGCAGCGATGACAGTGAAGCAGAGTTTGGAAAAGAACCCGTCGACGAATGGGGCAGCAC
TTTTTGATGGAGGGGACGACGATTGGTTTACGGACGTGCCAGATCAGCGTGAACGTTCGCGTAATAGTGGTGATGACTATAGTGATAATGGCGGGTCGAA
GGGACCAGGATGGAGAGATCACGTTAAGGATACGTATTCTGTTACTGCTGCGACTGAGCAGACGTCAGTGCTTGTTCCGATGGCTGGTAGTACGTTGACT
GCTGGAATCACAGGCAAGGGCTATATTTCTGACCAATTTCGGTATGACGATGTGGGTGGACCAGGCCTAGGGCACGATGACGATTTCTCCGTTGAGATGC
CTCGACCAAAACAAGAATCCGCCTCAGCAACCTACGCTGATCACAGTGCAAAACCCAGTCGACTTACGGTGAACGGCTACTTCTCAGAACAATTTCAATA
TGATGATGTGGCTGGTCCAGgtcttggccacgacgaTGATCACTCGGTTGCTATGCCTCGACCGAAGCAACAGCCAATGGCCACGCCTTTCAGTTATGAG
AGTGAAAGAGCCATTGAAAGACAATCGGAGCATGATCCTGACGATAGCTCTTCTCCTAATCAAGATTTCGAGCCGCGACAGACCTTCAAAGATAATTTGA
AAGACATGTTTAGCTCGACAAAGCGTCGCGAATCTACAACGAAAAGGAGGGACAAGAGAGGAAAGTCTAGCGAACCTCGTGCTCGAGGCAACGAAAATAT
GACATTGGACGAACTGAATCCGTCATACTCGTCGGAAGATGAACCCCGCGCGTTTACATCAGCCATGCCACGCCCAACTACCCTGACTACTACCCAGTCC
ACATTCTATGATAATAACGCTGACAAACTAGTCGTTGATGACTCGCCGGGGTTTTTCGAGACGACTATTGCAGAGCGAGAAGCACAACACAAattggaag
aagaacagaagcagcagcttgcaaGCGATATGGCTTGGGTAAATAGTTCAGCGCTACCGCCGACAGTTCCAGCACATCGCTTTTCTAGTGAGCAAGAGTC
ATACAGCA