Description :
From Genome Similarity Track
Location :
Scaffold_2048:1398- 2521
Transcript NameFunction/comments
Phypl_g14599hypothetical protein PHYSODRAFT_310534
Phypl_g14600hypothetical protein PHYSODRAFT_486841

Sequence
1123 bases(100 bases per row)
GAAGCGACGCAATGACGAGTAGTAGCAACCCGACGAGCTCGAACGATGCCATCGAAGCCAGGGTCTTGAACTTGCCGAAATGCTCATCGGAGGCGTACCC
CGCGGCGACGCACATGAACTGGCTGACGGAGTCGTATGTAAGCTTCATGGACGTGGAGCCCTTGTTGGACCAGCCTAGTTTCTGGAAAAAGTTTTTGAGC
GACTGGCTAATAGCGTAGGCTGCTATGCCTTCGCATATCGCGAGGATGACCAGGAACACACAGACGTGCTTGAGGATATTCTTCGCGTACTTGGCCGGTC
GCTCGTCCCATAGCGACGTGCCCCCGTAGCTCGTAGCGGCGACATCAGGGGTAAACTTCGGGGTGATCACCGGCGAAGTGACGGCGTGCTTCGGCACCTG
CGCAACTGGGAGTAAATTATGGAATGCCCTTGATGAAAGCTGGAAGACCTTAGTGCTTGCTTGGTAGGGAGGCAGCGCGCCATGTAGCAATAACACAACA
CTCAGTGCCTGGCATCTTCGATTCGTGGTGCCGCACAAACTATCGGTGCCATCGAGCTATGAGTCTTACGCGCAACGCGGGACGAGTCAGGCGTTTTGGC
GTGAAGCTGATACTGTCCATCTCAATCACGCCAGTCGCCACCAGCGCTGAAATTGAAGTGTTGGCGCGTTTACAGCCGCCGATTGGTTGTGAAGGAGCCA
ATGGCTCTGACCCTGGCTGCAACGCAGACGGCCAATGCAAGTATTAATGTACCGCTGTACTTGTATTTTGGTATTAAAATACCTACGTGTGAAATCAAAA
ACGTCATTCTCGGTACGGCCTATGATTTGCTGAATCGGGCTCTCCATGTTTGTTCGTGGTGTGTGCCGACAGTGTCGGCAcacaccacgagcagcgtaAC
TGACGAGCAGCGTAGTCGTGCCATAAGAAGATCCTTCGTACCAAAGCATAATCGATTGCCGTGATGTATTACTCTGCGTACCGCCGGAGCCAGCAAACGC
ACTCATCCtgctctgattggctgcACAGGGTCTCCAATAACTGCAAGAAATAGCATATCGTAAGGATTTCGATCATCCTGCTCGACTGCCAAGATGGACC
GAGGTATCTGGTCTtggaagagc