Description :
From Genome Similarity Track
Location :
scaffold_30:139790- 145657
Transcript NameFunction/comments
Plaha_PHALS_07337hypothetical protein
Plaha_PHALS_07338FtsJ-like RNA methyltransferase
Plaha_PHALS_07339myotubularin-like protein

Sequence
5867 bases(100 bases per row)
AGCGACTCGAAGCATTGCAGGTGAATCAAAAATAATACTGGACAGAAACCCACAGGCTGATCTTATACATTTTTAGGAACGGGCTCATAATCGTAACAAG
GCTTCAAAGCGGTCACGGCGTTTGGTCATTGGTATGCACGAGGTTCGACGAGGTCTTTTATGTCGCAAGATTGTTTTGCTTGTCGTTGCCACAGACTTTG
ATGGGTTTAAAGCAGTCAAGCTTCGTTAGTAACGACCGCTAAGAGCTGAAGGTCCTTGTACTCGCTCCGATGAATCGGAACGTGCAAAGGCTTTTCTAGG
CTTCTTTTTTTGCGCTTCTTTTGACAGCTTAATCTCGAGATGGCAGGAGAAAATTAGGGAAAGTACTTCAAAGGAGCGTGCGCGTCAGCTGAGTTGGTGT
TTACTCTGTCGATGGCGCAAACGATCTCTTTCAGCAGATCTTGCAAACAAGCTGACGACTTCTTGACCTGATATTTATATTTGAGTCTTGCGCGGACTAT
TACTGCGAAGTTGCCAACATCGGTAGTATTGTCTTGGATCAACAGTAACTTCTTTGTTTTGTGCTTTTCTCTTTCCGGGGTTGGCAGCAAATTCATTGAT
GCATCGACAAGCGTGGAGTTGGCTCGTGCCAATAACATCATTTGCTGCCATCAAGTACTGCAGGAAGTTATCGTCGTTACTTAGCGATGTATTGTTGTGC
AAAAAGCGTAGTTTGAAGTCAAATTTTGTTTCGCTGTAACTGTTTGTGAGTCGATCTTCTAAAACTGCTACAAGTTTGGATGTAGGTAAACCAGCACGCA
AACCTCGTGCGACAAGATAGCGCTCGGAACTGGCAGGGCGGCAAGTCTAGTACAACATACAAATTAATTTTCTGCCAGAAGTTTGCGATAACAGTGGCAC
GTACGATGGGCTTTACAACTGCAAAGCATTTGAAAGATTGATGCAAAATCCAACAGATCTCTATCATAGCTGGTGTTACCAACTCAAATGTCTTACAGAT
GAAATCCCCGCCGATTCGAAGTGCAGCAAACATTGCAAGAACCTCTGCCAAAATTAATCGAGTCATTATGGATTCCTACACGACAGAAAGATTACCAAAT
CCATTTCATTTCATCACGAAAGAAGTGCGCTCCCACCTGATTCAATTGTGATCGAGCATCAGGAAATCCTCCATCAGCTACAGCCAGGTCAACGCCATCG
GGATGCTGCCTTCGTACACAATCACGAAAGCTGTGAACGTTTGCAATCGAGTACAAATTACCCGTTCCGTCCTCGCCGTAACAAATTGTCATTGACTTAC
GAAATCTGGTAGGCAGGCGCCAATCGCAATCATTGGCTGCATCTTTCAGTgtgatgccatagccatgaCCTTCTATAGCGATTTGATCCATTTTCCACAA
TAAATATTCGGAAAACCCACCTGGTCCGCCACAAATGTCTGCAAAGCTAAATTTGTCACCACGTTCTTTTAGACTGTACGTCCATTGAAAGATATAATCT
AAATTGGCTAGTTTCATTGCAGAGCGGTTTATAAAATGGTATCTTCCCAGTGACTCGAACTGATTCGTTGCAGTGCGAGCGGTGAGGAACTCAGAGCTCA
CTAACTCGTcgaatttttctttttcctGCTTGAGTTCTTGGAGCAATGTCAAGTCAATCAATTGTTTTCTTATCTCGCCAACCTCATGAATAATGTCTTT
TGTACGATCAAGCGCAATTTCGAGTGCATCAAACCCTTTGCTCTGGTACAAAAGCGATAATAGACCATAACGTCCCACTTCAACGCTATTGATCGGAAGA
TCAGCTAGTTTGACTACCAGCTCTGTGCCAGGTAGAATTTGTGGAAGTTTGTTGATTTTTCTGTGGTTCATACGACGATTTACTCGACCAAAAGACGTGA
TCCCGATGTTCGCAATCAACTCTTCATTTTCACTCATCGCCTTTGTAAAACAATGGAGACTAATGATACAATTTATACTCTCGAAAAATTTAGTGGTTGT
GTGTATTGTACCGGGTATATTTATTGTCAGCACAAGCACATTCGACTACCTATAATATACTGAGTACTGAGTACGAATCTATTGCTGTGCACTTAACGCT
TCAAAACACACGCAGACTCACGAGGCAAGAAACAATTTGCCAGTAGTAGCTGAGAGATGCGACAAAGGGCACAGGAACAGCTTTGCAAGCAGTTAAAGCA
CCTATCACGTCTTACTGCTAGCGATCAACTGACTGCGAGTGAGCTGATCCGTCATTTACACTGCCATCACTTGGCACAGTGGCGTTACCATTTGAAGCAC
TGCTTGGACCCCTTGCAGCACGATGCACAACGGAATCCAACTCTGCTTCTAGCTGCAGTTCTCGTGCGACACTCTCGCTTAGTAATTGCTCCAAATATTT
TATGCGACTTTGATCAGGAGCCAACAACAAAGCTTCGCGAATGTTGCGACCCTGTGCGCGCTGGCGAGTGCGCTCCTCCACCCCACGATGATATCGATCG
ACGACGCTGGCGTCAATAGCGAATCGATTTTCTGCCACTAAATCGACGTCACTACTTGCTGGCATTGTCATATTGAGCtcatctgctgtaagtggCGACA
AGCCATCGTAACGTGCTGTCACACTTGCCGATTCTTCCGAgtcgtcgtcgtcgtcgCTCATGTCTGAGCAATCCGACAGCGTTTTTGTCCGAAGCTCATC
GTAATCGTGAATCACGTCGATTTGTAACTCCACCTTGTCTTCGTCCAGATTGCCACCAATGGGCATTACAGAAGGGGCGTCCATGACGCAAGTATCGCGA
GGACTTCCATCTTCATCAGAGCCGCGGTTTGAAGTGTCATCGTCAGGCTTCTCTACAGGGTCCATAAACTCCATATAGTCGGGATGACTTTCTGGATCCC
ACCGGAAAAACATACCATCCCACAAAACAACACGTTTCAGATTTGCGCGAGGGTAGAGCACCCGATTTGTTGGACGGTAAAGAGGATTTTTATATGGTGT
TGGATTCTCCAACACTGGCGTCCATACCGATTCAGTGCGCTCCCATACTTTATCTAACACGCGCTCTCGCTCCGAATTGTATAAGAATGTACCGTATAGA
CCAGAAATGAGAGAGTCTGAGATGTGAAGTAGAAACTTTTCGTTAAACTCGAAACACGCCGGAAATTGTCGCGTCATTTGCCATACACAATCTAGAAATT
GCAACATGACAGGTGATCGTTCGTTTGGCTGGTCAGTTATATCCTTTCCCACGCCAATTCGATCTGCAAACTTATGTCCAAAGGAACACCACTCCTTCTC
TACAAGGCTGGCGAATCCACGGATAGAACGGTAAAATGGGTCGAGAATGAGTTGTGCCAACGCTACAAGCTGTGGCGTGCGGTCCCAGCCATCACTGCAA
TGTACTAAGACTGACGCGCCATCTTCATGTAGCACCTCTGCAACCCTACGGGCACCTGATAGCACGCGCATAACGTGCTTGAGCCATCGAGTGTCTTAAT
AATTTAAAGCGTTACAACATGTCAGCGCGAGCACATATGCAATTGTAAAGCAAACTCACTTTCAAGACGATTGTGATAATGTTTGTCTCCATCTTCAACG
CTGCTTGGGCTAACAAGAGCTAAATCGATTGATAACCAAGTTAAATTTGATACATCACAATTTCAAAAGGGAGCAAAGACGTACATTTCAAAGCATCTAG
CGACTCGCGCATTTTGTGGATATTGGCGATTCCCATGAACTCAATGGTCGCGTTGTCGTAATGCTGTGAATTTTCCACACCTAAAAAAATGATAGTCAGT
ATTAAATCGTAATATTCGAAAATTTCATCGTTACCTTTTCCTTTTAATCGATTTCCTTTTGTAGCAATGGGCTTCCGGGCATCAATTATGTGAAGAGGAG
GTGCCATGTTGGAGCTATTCTTGTTAGCTGAGTCACGGTACGCGCGTAAAAGTATCCGATCTGGCTCGGATCGATTGCCTGCCATGCCGTAATTCGGCTG
ACTTGAGCGAGACAAAACGCTCTTGTTCACGGGATGGCGCCACACGACAACTGGTAAGCGTGCGCGGGATCGAAAGCGAGCCGACTGCACAAGCTGTTCC
TCCGACATGATAGACGGTACAACCATCAGCTGGGGATATGTGGGACTGAATCGAAACTTGGAATTCTTTAGAAGGCGCCACGTGATGGCTCCATCGTCTT
CCGTTTGTTTTTTGGCTGACAGAAAGCCAAGACGCTGGTATTCAGCAAAAGGCGAGTACACAAACCATCCATTGTGCTTTTCGGAAATTGGACAGCCACG
TAATTTGGCCTTTTCCGTGTGGTAATCAAATGCAAACAAAGCACCAATCATATTTGGGGGCTTCATTCGCAACGTAAGCAAATTAAGCCAGCGAAAGTCT
GGAGTAGATGGCAGCTGGTCGTATCCTTTCTTGCGAGAGTACGCGTCGTGCATAGCGAGTCGCAAAGTACGCAAATCTTTGCACGAAATAAGCAACATGA
GCCCGTCCCGTGTTATGACGTCGATGGCTGCAAGTGGTAACTCAAACGAGCCAAACTTCCATGACGCGTCGTAGGGAACAAATGTGATACGATACGATGT
GATCTTCAGCACGCCTTGTACTGCACGGTCACTCTGAGACATCACGACTAAATTTGTTACACGCTGCACATGTTCCAAGACCGACTCTCCTGGAAGCAAC
TGAAAGTGATCGCTTATGAGTGAGTCCCGGAGTTTGGAGCGTTCGACCGTGCTAGAGACCGTTGTCATTGCCTCGTCAGCTGGCTCAGAGGGTATACGAG
ACGGTGTGGCTGCCGTAGACGTCTTTTTGTTGAGCATCACCTTGCCCTGCTCTAATGCCTGAACAAAATTTGCCCTGTCTTCTGTACTATAAAACGTAAT
CTTTTTGTTCACACTAGCATTTCCCGTTTGGATCTTTAGTTGCATCCCAAGTCTCGACTGTGGCTTGGCTGTAACAGCTGCACAACTGTACTCTTCGCGC
TGGTCATGTGCAGATAGAAAATAAAGCATTCGTTCATCTACGTCCACCTGCAGTTGAATGCTTGCACGTTTACTACCAAGTTTTTCCAAAACACTATCGC
TTTTCTTGACGGTAAACGTAAACCGCGTCACTTCCGACGATGGTGCAGCATTGCGACTAAAGCCAAAAACATTACTGCTATGTGTAGATCGACTGCGACC
GTTTTCCACTAAAAAATTGCTAGGATCGCTCAACATGTCGGTCGGTCGCGCTCCGGAAGTGCCAGAGTGTCCAGGTCGTTCAAAAAAGCTGTTGCTGTGA
CCGTAACTACCAAGCGAGCTGCGTCCTACTGCCATGTCCGGACGTGGGATCTCCATGTTGTATCTTGGGCTTAAACGGGCCTCTACACTTGTTGCGTCGG
TCATGTCAAAAGTCAAATCCGTTCTGCTGCCTGACGGAGCTGTTGCAGCCCACTTATTGCCACCGTAGGGACTTGGGGGTCCCGTTGACTTGTATCTGCC
GGCGACAAAGTCGTCTGAGCCCTGTATTGATATTTTCCGTCGAGAAGGTGTCCTTGTGTGACGTATAGGACTAGAGTCAGCTCCTTGAGAAGCAGAAAAG
TGAATTATGGACCTAAGATTTTGACGTAAAGGCATGGAATGACTACCAGATAGGTTTGCGGTCGGAGCAGGTGGTGGAGACTCGCTCTCTTCGCTTGGTA
GCTTGCCAATGAGTTTCCATACGTTCGTTGTGGCTTGGCCGGCTTGTGCTAAATTCTTCTCAGCCATTAGCAACTTTCCAAGCGTAGTTGAGTCCATCGT
GGACTGGCGCTGGGCCAAGTACGCGTCGTCCTGGTCGTCAGCAGGGACTTCCGTCGTCATGGACGCC