Description :
From Genome Similarity Track
Location :
Scaffold_20:1397806- 1405820
Sequence
8014 bases(100 bases per row)
TCGTCTCTATGGCCTTTGTCATCCCGCTACCGAGGTCTCGCAGGGGAAATACTTCGTTGCTCCAGTTTCAGTGCTCGTTCACGGGATTCGTCATTGCCAA
GGCTATGTCGGATACGACTGCGCTAAGTGTAGCTTAAGTGTTCAAGGAAAGTGTACCGACGGTTCGAAGCCCCATCATTGATCAGGCACGACCGACCGCG
ACCCACGCTTCATGAGCGAGGTGTTTCAAGCATTCGCTGAGATGATGCAGTCAAGGTGATGAGCGACTTTAAGCTACTGGCCACAGGCTAATAAACATCT
GGAACGCTCGATGAAGTCGGTGATGGCTTCCGTACGAGTGTACGCAGAAGGTCCTCTGCCGCAGGATTGAGATGAAATCGCCGAGAAGCTGGTATTTGCT
ATTAATACCTCTCCGGATACTACAAGGAAGAAAACACCGTTCTACCTGGCTCACGCTTAGGATGCGCGGTCGACGCTGCGGGCGATGTCGTCATCACTCA
AACGAGGATTCGACAGGCAGTCTGACGCATTGGCGTGGCGACGTGAAATCAATCGACAACACGAGATCGCCCTCACTATGGCCGAAGCCTATCAAGCTGT
TGAGAAGGAGCGATGGGCTGAGAAGCATAATGATGCCTTGAGTTGACTTGAAAAGGCTGCTGTACCCCCCAACCAAATAGAAACGAGCACTCGGTGGACC
CTCCAGAAGCTTCAGAAAGGACAAATTATCCTGTAGGTGCCCACCGAGACCTCGTTTTGGGAGTGGGAGCAGGGTGTGGCTGTAAATGGAGCGCGTCAAA
CCAGGCCTCACGAAAAAATTAGCTCATTGATGGCATGAACCTTTCGGATCAAGCGAAAGGTGGAAGAGCTCACGTATGAGCTGGAACAATTAGACCGGAG
TTGGTATCGCTTCTACCCAGTAGTGCATGTGTCGAGACTCAAGGCTGTAAATGAATTAAACAGTCGACCGAAGACTCGTTTAGTACCAGACGCGATTAAT
GAATCAAGATTCGATTTTGATGAAGAGTTGTTACCTGAAGACAGCTGGGAACCAGATCAAGTTGCTGGCGAGTTTGAAGTCGAGATCATCCTCGACGATA
GAGCACCACTATCAACGAGCACGGAGCGTGCTGTACGCGAGCTCAAAGTCAAGTGAGCTGGCTGAGAAGATCCAACTAGGAAACCAGTATCCAACTTGTC
GAGTGGAGGTTTGCTGTACGACAACCTGTGAGCCAAGAAGGGTGAGAACCGGCTGCAGATGGTTAAAGTTGCGGACGGACTAGCGTGACTGGGTCACGTG
TGAATTGTCCACAGGGCGATTCAGCCTGTGGTAACAGACGCAACAAGCTACTGGAGCAACGATTGGTATATGCATTTGAAGGACATCGTGAACATTATTA
CGCTTTGGAAGGGGATTAAGAAAAAGAAGACATGAATGACGATAAAATTGCGACCACTGAAAACGGACTCTCGCTGGACCCCTCAACAGTTAGCTGGATC
ATCGGAGAGCGTGGTGGGACATGCAGCGAGGATTCAAAACGACTCCAATTGCCTGGCAGCAGTGGTCAAGGGTGTTAATGAAGTCGAGTCCTCACTCTTC
TTCTCCTCATCGTCGGGAAGGATAGCCTCGGCGGTTGGAGCCACATCTGGAGCCCGCGAATCCGCTGTATCAGCCTCAGCAGACGTAGCAGTCGGAACGG
GATGCGGAGTACCCGGTGGCGTGTCAAGTAAATCGCGCCAAGTCGGAATAAGCTCGGATGGAGACAGAGCCGGATCGACTACCACGCCGCGGTACACATC
CACGAAGCGCGGCTGAAAAACACTGAATTGCGATGGCACGGGAAGTACGTGGTGCTGTACGGATGCTGGTGCGGCGCGTTCATCATTTCAGTACGCCAAG
GCTGACGAACGTCCAGAGACGGAACTTCAGGCAGCCAGTTAGACGTCCGAAGAGTGAGCGACAAGTTCTCGATGGGGTACCACATCTTTGATGTCTCCAA
GAGCAGCCCGGGGCGAGAAAACGGTGGATGAGAAGAGCCAGAGGAAACTGAGTCACGAGTCCACGCCATGTACTGCTCACGATACTTGTTGTGAAGACGA
TCGGCACAACGTTCGCGCTCACTGAAGAGCTTCTTCAAGAGAGCTTTCAGAACATTCATGAGCGCTTTGTCGTGGTTACCGTTTTTTGTTTCCTCGACGA
GACCTCGCTCAATACCCGCCAAAGGAATTCAGTGGAGACGCTCCCAAAACGCAATCCCGAGGTCACCCTGCTTGCCGCCATTGTCTCGAAGATTCGCCCA
GATCTTCTTGAGACGGGTCTCGATTGGGGCGCGTTTGGAGATGAAGCCGCTCGGGTCGAACCGATGGCGTCGAAAAGACACGGCTGGTTTGGATGTAGCC
GCTAAGGTTGCTGATAAGGATGATCCGGATCCGTGTAGTTGAAGAATGCTTGGAGGCCTTCCAACGTTGTACGGATGATAACTTCACCTGATGGTTCAGG
AAGTGTCCTGTGTAGAAGACGCTTGAAACACTTCTTCGCACCCGCATCGGAAAATTCCATTTCCAGATACGGAAGATCCCACGGTGGCAGAAGCCGGCAT
GGTCGGACAAGCTCCAGGCAACACGCGGTGAGGCAACGGCTCAACCGACAGTGCACCGCCACGACGTGGCACCGAAGTGTAGGTAGCCGTAATCTTGCGC
CCAGGTCCAGCATCAAGCGTTCGAGAAGACGGACGGAGATACACCGGAGCAGCAGGAGGAGACGGTTGCGCTTGTAGAGCTGGAGAGGACTAAGGCGATG
GACCACGCAATACGACCAGGGAGGTCGCCATTGGCGAATGATTTGGCCGAGGAGGAGTCGGAGACCGAGCGGGACCAAGACCGCCCCAATTGCCATCGGA
ATTTTTTAAGTCATCGCCGTCAGCTAGACTTGAATACTCGGTAGGTGACCGCCACCACTGGTATCGCCAGCTGGAACATCCGCCAAGGATTCATCATCAT
CATCGCCGTCTCCAAGATCATCATCATTATAATCGTCATCAAACTTCATGGAATAATCAGCCGAGTGCACACTTGGTACGGGAGCCGTTAGAATTGTCGG
GACCGGCTTTGAAGACTCGGAGGCTTTTGAAGGAGCTGCAACAAGGACAGGTCCTGATGTAGCCCGAGGGTTCAGTCGTCTTGGAGGTCGCGGCAGACGA
CGTTTCAAACCTTGCCCAATGAAACGGTGCTGTCCGACGCCTCATCTTCGTCATCTGAGCCGACCATGAGCCGGTAATCCTTTGCCTCACGCAAAGCTTC
TTCGGCAGCGCGTATACCAGCAGGAGAAGGAGAAACCGTTGACGCAGATGGCTTAGCCGCGTCATGGGCACCCTCAGGTGAAGTCGAGGGCGCGTCAGCG
TTCGGTAACATCGTTATGAGCCCCAGAGCGAACAGCTTTACCCGAAGAAGCGGTGGTAGTGCCTTGAGCCGACGTGACACCACTCGAGGCAGCGTCAACC
ATTTCCACGTCACTCTGGTCACCGCTGAGGTCTACAAAAGCGGATGTCGGCTGACAGGAAGACGAAGAACGCGGTGTAGCTGATGACGACGCTGGCTTGC
GAGGCGGCAACCATGAGCGAGGAGATGACGGCACAGACTGTGACCCAGCCTTCAAGTGGCGCCGAGGCGACTTGCCAGAAGGGCGAAGGCGGGTCTTCTG
GTGTTTCTTCTGAGCGGCCTGCTTCCACGCCTCGGATTAAAAAGAGAACGATGTGAAGTCTTGGGAGTCAAAGGCTGGGCAGGTGGTGTATCACCAAGAC
CAGTAGCTGCCATAGAAGTACTGGCATTGCCGGCCGGGATGAGAGCCTTATCCTCACTAGAGTCGTCTGACTCGTAGTCCGACTCTTTGCCATCTGGACG
AAGTTGCTTGAGAAACTTCCCATGAGTCATCTGGTGAGCCGCTTGCGCTAAGGCTGAAGAAAGAGCCTGAGGTCAGGCGAAGACGCGGCAGCAGACTGTA
TGCGTTGCGAACCAACTAAAGGGGGCCCAGAGCATTTAGATCCAGCTCACCTGTGGTGAGGCCTGACAAAAGAGCTTGAAAACGAACGTTAGTTGCTGAG
CCCACGGTGGAAAGAAAAATATGTGAAACGTATCATGCGCAGCCAAACGTAGGACCTCTGGATCCATCCCGGCCAAATTCACGTGTGCGCGGAGAGTACG
GTTGACTTAGAGAAGGTGGGTATTGCGGGCCTGCTGATTCTCAAGAATCCTGAGCGTGTCATTGTCGATGTACTTCCCTTTCGAGAGATTGACCAGGAGG
AGATGGAGCTGGCGAGTTTGCTCGGTGCTTGCGTCAATTGAAGACTTGTACACCTCGCGTTCTCTAGCCAACTTCTTGTTCAGGGTAGTAATAAACGCGT
CCCGCGCATGGACTTCGAGGTGTCGGCGCTTCAGCTCTTCTGAATGCTGTTCCATAGAATACTGCACACTCAAGAGCATGGCATCATTCTTGGCATTGGA
CTCGCGGAGAATCTTGATGTTCATATGGAGAGCTTCGACTTCGGCGCTGGCTGCCTTCAAGAACGCCTCCGCATTCTCCCGAGCCATGATTTCGGGATCC
ATCGAACGTACGGCGGTAGCGGCCTCAGTCTGAGCGGTCAATAACTGACGCTCCAGACTGGCGACTCGGTCAGGTAGGTCCGTCAGCGCATCAGGAAGGG
GCTGTACGGCGGCAACAACATCATCGAAGCCCATCACAGTCTCGAGACGACTCTGAGTACAAACATCACCGTGACGAGGAAAGGCAACGTTGAGCGGCTC
TTGATGACGAGCCATCTCAGTCAAGTACGGATTAGTTGATGTCATCATGCGATCGACCGACGTTTCCGTACGCTCAGCCAGCATGGCGCTCAACGAATCC
TCAGTGAGTGGTGGGGGACCGCCAGCAGGGGTAGGCGGAACCGTAGGATTGGCTTCAGAAGCGGCGGGGGATGCTGCTGGAGCCGCAACAGGAGGTGAAG
GCTCCGAAACAGGAAGTGCCCGTGTTCCAGTCGATGAAGCTGCTGTCGAAGCAGACGGAGCAGGCTGAGGGTCGCTCGAAACCTCGGTGCCGCCATCCTG
TGAAACAAGACGAGGGAGACATGGTGATGAAGAAGGTACCGATGATTCACGGGGAAGATGTGCTGGCGTATCTCCAGCTCCTCATGTCCACGTCGCCAAC
GGGGTTGAATTCTTGAGTCACGGCCCGATTAAGACGCTTGGACATCTTACGACTTGATAGTGATTTTGAGAATGATGAAATGTCACAACGGGAACCAGTA
CCGTGGCTTCCACTGCGACAGGGGCAGTTGTGGTGTAGTAATTTCTCCAGAGTTGCGGATAATCACCAGTCAACAAAGATGCGACACCGTCGAAGATGCC
CAAGCGACGAACACTCGGTCACATGATGTACGGTGACTCCAGTGTGCAAGAGACTCGACGGTGTCACTACCGAACACTCAGCGGATATTGGATATAGTCC
AGACACTCGATCAAGACTGTCCTTATTATTTATTAATAGACTGGCTGGATTCGCATTCAGCGGCCAAGAGCTGAGCACCTACGGTACAAACCCTCGGTGG
CGGTTGGGATGAGTTCGCGGAAGACTCCATGACACTTTGAGGGCTCAGTAGCCGTCTGGGAAAGGGCGCGAGCTGTTAAAGATGCGCATGCGACGTTGCA
GACGACGCTTGACGTGTAAGAAGATCCATTGTTAACATGATATTTGTAGACATAATTAGAACTTCTTATTAGGAATAGGCCCGAAAGGGCAAAGATAATA
ACAGAGCAGAATTGCTACTCAAGCACACAGAGCGACGTTCGGCTTCAAGTTAAGCGTCTGTTCAAGCTTGTTTGGGTGTGTTGTGCCTGTCGGTGAACCC
GAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTGTGTGTGTTTTGGCCGATTAATATCGAAAGGTTTACGTGACGGCTTATTGTTGCCTAT
TTGCACGACTGGGAGTGCTTGTCTTGCATCCCTTTTATTCTTCCAACCGAGTGTTGAGCACTCGGTTCCCTCGTAAAAAATTACCCGTGCCTGGCGCGCG
TCCGCTGTTGGGATCACCATGATTCATAACACCTATTTTATTTGCTCGTGCTAGTAGTGTGTTCTTATTTTACTAGTTGGCCTATATATGTAGTTTACAA
GGTCCAGTCTGTCCAGGTGCAAGGGCAGGACTGGGGCTTCAGGTCCGCATGAATGATCGTAATTTATCCTAGCAGACGTATTGTTGTGAGAGCTTCCTAA
CTACATTTGTAGCTAAAGTTCACGTGGGACTTCCAACACCACAAACCCACCGGGTCTCAGCAACAGGTAGTCGAGGTCTTCAATGAAGAGCATGATCGGT
AGTGTCTCCTTCTCGATCACGCTCCAGTGGAGCTGAGGACCAGTGAAAGAACCACGCTTGCGTACCAGTAGATCATGGTCCTGCTCCGTAATTGCCACGC
CTTGTTTCCATTCATCCACTTGCGTTAGTATATAAGCCCAATCGTAGTCGCTAGCATATGTAAGCAACGAGTAGGTGGCCTTTTCACGCGGGTGTGTCAT
CATGACCGAGCTCTGCAGAAGTATTTTTTTCCTAGAACGAAACTGCGGAGCTCATCAGCCCCCAACGCAATGCTTACCCCCGAAGAAACACGCTTCGTTT
TCCGCTTATCTGCAAGTGCACGAATCAACAGTAATTGCAACGGGGAAACGGTGCGAGCGTAGTCAACTAGACTGTCGCGCATCCAGTTCGTTGCACAGAT
AGATAAACTGTTGCAATCTTCCAGCTGTGATTGGTGCCGGCACAAAGTAAGCTCTTGAATTCGTTTCGGGTCATGGCGAGCCTTCTTCGCCAATCATCTT
ACAGCACCACGTAACTGAGCGTTGGTACAATGAGGATATCTTCAAACTCAACTCCAATCCAAATTAACTGTACAATCACTCTAGAGCAGCGAAGTAACTC
TCAATTGTATTCGAGTAGAGCACGAGTTTGTCAATCCTTTCAGTAAATGGCCCTCCCGTAGCTCAACGAAACAGCTTTCCATCGATACTTGGAATTGTAG
AGCCAATGTATAGCTTCCTTGCATCACACAGATCGGCGTGAACACACGCTCATCCGTCTTATAATAGATTTGCTCTCAGCTTTCCATCGCCACCGCCAGT
TGCCATAAGCTACGGATGACATCGAAAAGACCGTAGAGTTCATTTCCTTTCAATCTTATCAGATTTGTCTTCAAGTTTGGTATAACACCAGCAATCGCTT
CGGTCATCAAATTCATCGGCTTGTAGTCCACTGCTTGGCGAAACCGTTGACCTTGGCTTCTTTAAAGGCAGCTCAGTACATGATCCGTGACTGCTTCATC
AGCCCTCACTAATTTTCAGCTCAGCAGCAAGCAACATCTCGAGGCCGGCTCTTGCTAGTTCCTGGGTATCAACATCATTTGCATGACCAGGACGAAATCA
CTAGAGATTGAATGCTCGTCATCGTCGAGTTTACCACCTGCGAGTTGCTCTCCACATTCATCCCGAGCGATAGCAGCACGTCTTTTCCAACCATGAATTT
ATCATCATCATGCTCGATTGTGAGACCGTCGACCGGTTCCGCGAGCTCCACAGGACCAGCAGTAGTGTGTAGACGAGTTGAGGGCAGTACCAAATCACGA
GCTTCACGTCATGGCTGGTAGCAGCGTTTCTGATTACTGGTGTGCTCAACGGGACAGACTTCACCTTGCCGTCAAGCCGCCCAAAATCGTTGAAGGTTCT
CCTGCATAGCAAGCACCTATTGGGGCCCGTGTCCGCGCAGTACTTCAGCTCACATACGTCGTTCAGCAAAATGGTGTTCTTTCCACCCACATATTTCCTA
ATAGACTTCATCTTATCGTGGCGACTAGTATGAAACTTATTCGGTAGTTCCTTCTTCTCTTCCGGAGACGCGGTGGGGTAATTCGATACATGGTGTGGGT
CACTGCATTTCAGA