Description :
From Genome Similarity Track
Location :
Scaffold_53:139744- 141190
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16052hypothetical protein
Phypa_INRA-310PPTG_16053hypothetical protein

Sequence
1446 bases(100 bases per row)
TACCTCGTGATCATGCGCATTTTCGATGTCGTAGACGATTCCGTGCTTGTGCAAAAGTCGATTTTGGCCGAGATGAACGACGAGCTCTTCTCAATTGCGA
TGCACCCCAGCGGACGCAAGATTTTGCTGCAACTGCTTAGTCCCCTGAACAAGAAATACCTCTCGGCTGACGACCTTGCGCTGCTGGAGCCGCCCATGTT
GCCGTCGCCGGAGGACCCGACTGTCATGGTGGTGAACTACAAGAAGGACCCAGATGCTCGTCGCGAAGAGCTTTTGAAGGGTCTGCTGCCCAAGTTGGAA
GAAATGTGTGCTGAGAATGCTGAGGCTTTGATGCGCTCAAAGGAAGGCCGTGACGTGATTATTGAGGTCGCTAAACGGAGTGAGAGCACGGATCTGGCAG
ACAGCATTGCTGCTGCTGTTGTGGCGGAGCCTAGTGAGGAGGAAGTGGAGCCGCTTCACAGTGACGCAAACGGACACTACGCTCTGCGCCGCCTGATCAA
GGAAACCTCGCTGGCAGAACCTCTGCTTACAGCAGTCGAAGAGCAACTACCGCAGTGGGCGACTAGCAACCGTGGCTCCTTTGTGGTGCTTGCGTTCCTG
GAGGCTGAGAACGCTCCCAAAAACGCTGCCAAGGTGGTGAAGAAGGCTTTGAAACCTGTGATGGGAGACCTGAAGAAGCTCACCAAGACGCAGAAGGGCA
CTAAATTACTTCTTGAGAAGCTCCAATAGAGAGGAGATAGGCTCAAACTTTATAGATCCAAAGGCTTTTTGTTATCATTGCATCATGATTTCACTGCTCA
ATCGTCTTCTTCCTCGCTACTGTCGTCGCTACCATCGTCCTCGGACGAGCCTGTACTATTATTTGCCTCACTGTCATCATCGTCATCATGAAATGCAACG
AGGAGGTTTCCTTCTCGCCAGTTCTTGACCAGGTCGAGTATCTTCGGATGTGAGTGAAGAACAGCAAGATATGACAGTGTTTCTCCAAACTGTTTGAACG
TATTCTTTTTAGTCGTCAACAATTCATGATCGTTTGTGTTCAAACTCACCTTGTTTGGTTTATCAACCAACTCAGCATCACATTGCTGGAGCATGTTCAT
CAGGAGATTGCCACTTCCGCAGGCAGCCGCATAGTGTAATGCTGTCATGCCTTGCGCCTGCGACATACACGTTGTTAGCAATTGTTATTGATAAAAATCC
ATTTTACGTGTACGTACGTCTTGCAACGAGAGATTTGAGCCAGCATTCAAGAACACCATGCCTAGCTGATGGAGAGATGCCCCTCCCTCAGCACACAGCA
TTAGCGGTGTCTGTCCAAATACCTGCAATTCATGATTAGCACACGGTTTAACCAAAGAATGATTTGACTGAAAACCCACATTTCGTGCATCGACCGAAGC
ACCCAATTCGATTAGCGTTTCTGCTGCAATCTTGCTTTCGCCGACG