Description :
From Genome Similarity Track
Location :
contig_30:139732- 141679
Transcript NameFunction/comments
g6244.t1XP_009538757.1 hypothetical protein PHYSODRAFT_307593 [Phytophthora sojae
g6245.t1hypothetical protein

Sequence
1947 bases(100 bases per row)
TATTTTGAAAGGTAACATGAGTGAATGCGAATCGACAGTCGCGTGATTTTAGGAACGAGCCATCAGTGCAAATTGCAAAGCACTTCTCAATTTGCGCAAC
ACTGGATAAGATTCTCTCCATGACTGCAGCTTCTCCGACGCCTCTGCTGCTGGACGGCAAGGCCACGAGCGACGTGGTCCGTACGCAGCAGCTCAAGCCG
CAGTGCGAGGCGTTCCAGAAGAGCCACGGCCGCCCTGTGGGCCTCGCCGTGGTGGTTGTGGGCGCCCGCAAGGACTCGGCCACATACGTGCGCATGAAGC
AGAAGGCGTGCAGCGCCGCGGGCATCGCGTCCTGGAAGATGCGGATCTCACTAGAGCAGGACGGTAACGAGAAGCCCGCGGAGAAGGTGACGGCGGAGCT
GCTGGCGACCATCCAGACGCTCAACGAGCGCGCGGACGTCGACGGCGTCATCGTGCAGTTGCCGCTGCCCTCGTTCTGCGACGAGGACGCCATCCTGGCC
ACCATTGACCCCACGAAGGACGTGGATGGACTGCACCCGGACAGTCACGCGGCGCTCTTCCAGTTCGCCACCAAGAAGACCTCGTCTCAGCACGACGAGG
CGCCGTTCAGTTTGCCCTGCACGCCTGCGGGTTGCATGGAGCTGCTGGACCATTACAACATCCCGCTGGAAGGCAAGCACGTGGTCGTGCTCGGTCGTAG
CCAGGTCGTGGGCCTGCCTGTGTCGTTGCTGTGTCTGCACCGCAACGCCACGGTCACCATGTGCCACTCGCGTACGCAGGACCTGAAGGCGCGTGTGCTT
GAGGCCGACATTGTCATTGCGGCTATTGGACGACCGCGCTTCGTGCAAGGCGACTGGATCAAACGCGGCGCCACGGTGATCGATGTGGGCATTAACCCCG
TGGAAGACGCCTCGAAGAAGAGTGGCTACCGTCTCGTGGGCGACGTGGACTTTGACGGTGCAGTTAAGGTCGTGCATGCCATCACTCCTGTGCCAGGCGG
CGTTGGCCCCATGACTGTGGCCATGCTCCTGAAAAACACTATCCAGTGCGCAAAACGACGCGTGCAAAAGCAGTAAAACACAGAGGATACGAGCGACGGA
ATCCATTCAACGCTTCCTAAAGTTTGGAGACTCACCCTGGCCCAGCAAGCGAACAAATCGACTTTGCCCGGCTTCGGCTGCTAATCCTAGTTGGTAAGGC
GACAATTGTAAGTAAAGCGTTCCCTGACCCCGTTCACTGCCTGTACGGGCCCGCTAGAAATCGTCGTGATGACCGAAGAGCAAGTCCTCCTCGTCCTCTG
ACGAGAACTGCCCGCTTTCTTCTACGAGCTGCACGTCTTGGTGCAGTTCCTCCCAATATCCTCCGTGTGATTGCTGAGCTAGAGGGGCTCCTGTTGCCGC
TTCATTATCGCCGTCTGCAATCTCCAGGTTAGTGTCCTCATCGTTGTCGGCAGCTTGCTTCTCGTGGAGATGGTTCACAGCTTCCTCCAATCGTTGCAGT
GCCGTCTTCGCACTAGCAGGACGAGCTAATGCGGGTTGTTGCTGATGCTGCTCCTTCGATTCACCTGTAGATGCAGCTCCGAATCTCCGTTGGCCCTGAA
GCAGTAGTCGCATGCAATCAAGTTGACCATACGCCGCAGCGATCTGTGCCGGAGTCTCCCAATCACTGTTCACAAGTGTTGGGTCTGCACCAAGTGACAG
CAAATTCTGTGCCACCGCTGCGCGACCAGAAAATGCTGCCCAGTGCAGTGGGGTATCACGTCTTTCGTCGGCGGCGTTCAAGTTTGCTCCGTGCTGCACT
AGTCGAGCAATGATCGAGAGAGCAGCAGGCGATTCTACCGCGTAGTGCACTGGAGACCGATGCAAGTCATCAAAAGCGTTGGCGTTCGAACCTCCGCCAG
GAGTCAACAGAAAAGCTGTCATGGCAGTATCGTGCGTCAAAACTGCA