Description :
From Genome Similarity Track
Location :
Scaffold_79:13973- 16031
Transcript NameFunction/comments
Albla_Nc14059350conserved hypothetical protein

Sequence
2058 bases(100 bases per row)
ACCGCTGGCAATTGGTAGATGGCATCCCTCCTTAGGATGGATACTCGTTACCACATTTACTCTATTTATTCATTTTCTCGATCGTTTCATTCACCGACAA
GCTATTAGTCGACGCACTAGCCTCAATACTGTAAGCCTTGTATCACTCACCAGATCGTCGGTCGGAAAATGCTCACTCAATATACTGTTTTGTGACGTAG
CGGGCATACTCGTGTCCCAACTTGGTCGAGTATAAAGCGACCGCAGAAGGCAAAGCCAAATTGGTTTCGGACTGCGTGAATTACATTGACCGAATGTACT
TGCCTTCCACGATCAATAACATGATCAACTTGCATCAGGTCAAGCAACAGGAACAGGAAATATATTGCATATTACTCAGTGCGACTCGGAATGAGCTGAA
TTATATTCTCAACAATGTACGACTGGCACTTTTATTTTACAAAGTCAAAGATCATTCTACCAAACTGCGCTCGGACCAACATCGGACTGTTATATTAGAT
TTGTTATGTGTGAAGCGCGTCACGGAACTGACCATCACTTCTCGAGCAATATTGCTGGATGCATTGATGGTGATGAGGCTGAGCGCCCATCCTCTGAGCG
AAAAATGGGTTCGGAATATCATTTTGAAAACGTCTGGAGATGATCTCAGCTTGCTGAAAACCTACACAGACGCCAAAGGGGATTTTCATAGCCTGCACAA
GCTAGTATTTAACGATATACGGGATGTCAAAATACGCCACGATATTCTCCAACATATCCACCGGGAAGCCAGCATCCAAACTGCGCACATGCGATTAGGA
ACACGAAAGGCTATGGTACGAAAATTACAAGCATGGCGTAAAGTGTTGAGCGATGTAGATGACACTTTATACTCTTCTGGCGGTCGATACCCAGCAGGCA
TCGATGTGCGATATCCTAGGCATGTAGTGTACCCAGGCGTACTCTCCTTCTACAGAGAATTAGACATAGGAACCACAGGACCCGATGAGTGGGACGAAAA
CCGTGTCGGAAATCTGGTATTTCTATCAGCTAGACCTCATGTGTACAAAGACATGTCTGAGAAGAAGTCGTATGCAAAGTTTGCGGCTTTGTACGCACGA
AAAAAGATGCATACGTTGCCGACCATGCTGGCAGGAAGCCTCCAGTCAGGACGTGCGTATATGGTACGAGGAAATCTTGAGCCAATGGCTTTGAAAAAAT
ACGAGAATTTCTGCGAGTTTTACCAGCTGTACCCAGAATTCAAGCATGTATTTATCGGAGACAATGGGCAAGGCGATGTACGAGCTGCACAACTGATTGC
AGAGCGGTTTGGTTCAGGGATCTTAGAGGCCGGATACTTTCATCTCGTACAACCACTAGAGAAAACGTATGGCATTCGTACGAAAGAAGATCTGGAGAAG
TGTCGACGGATGAATATAGTGTTCTTCAACACTTATGTCGGAGCAACAGTAGAGGCCTACAAACTCCAGCAAATTCGTTTGTCCGGTCTGCAAAGAATTG
CACAAGAGGCTGCTATGTCGTTCAAGAGTATCACAAATTGGTCGAGCGCAAACACTCGTGAAACACAGCGCATACATATGAACCAAGACATCGAACGAGC
TAATGCTATTCTCCGGCGGCACAAACTGATACCAATAGACTTTATAGCGAAACCACAAGTGTATGCTCAAAACGCTTTGGTTCACACACCTTTCGGACGA
GCAGTGGTTCGTAAGTATCGTCCGATCGATGGGATCTACAAAGTAGAGCTGTTGGATTGGAAGACACAGAAGAGACTTGGCTATTTTGTAGAGGACTCTC
TCGCAACGTATACGACCGGAATTTTTACCAATTTGGAGAAAGGATCATGCAGTTATGTCAGATTTAGACGCCCTTCGGTAACCGTCTTGGCTCCTGGTAC
ATCAGTCAAAACTCGGTTTGGTAATGGGCGGATCCTGAAGTTTCGACTCGAGGATGAAGTTTACAAGGTGCATCTTTACTCATCGACTGGTAAGATGCTG
GCAGCCGCTTACTTAACTTCCAGCTGCATCAAAGTTGCCAGCAAAGAAAGCGATTCAA