Description :
From Genome Similarity Track
Location :
Scaffold_23:139718- 146236
Transcript NameFunction/comments
Physo_132886hypothetical protein
Physo_132887reverse transcriptase

Sequence
6518 bases(100 bases per row)
CTTCCGGATGCGGTGCGCTTGAGCGACCGCGACCTAAGCGGGTACACGACGATTCGTGTACCTGAGAGTCTCAAGGGTCTCCGTGCCAAGTACTTGGCGC
GCGAGGACACGACGATTGTGGGACCTCGGGTGCTGTAGGTGACCACAGCGCTCGCACTATCTTCGCGTCGGCAGTGCGAGGTGAGCTTCGTACGCCCTCA
CCATTTCTGGAACGTCCTGCGGCAGGACGTCCCGTGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGTCG
GTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGTGGCGGTGGTGGGAACACGCCC
CGGGTATGGTCAACCAGGGGTTGACCTTGGCCCGACGCTCGAAGAGCGGGTCGCTGCTGTGGAACAGCATCAGAGCCGGGAGTTCGCCGCTCTGATGCAG
GAGGTGGCGATCCTGAGGGCTCAAGTCGCTCAGGCCTCGCAGACCGCGTCGGACATCTCTGTCAACGTGGGAGGTCGCGTCGCACGCTTGGCCCAGCGCG
TTTACACGCTGGAGCAGAGGTTCGCTCCACCTGGGGCTTCCGGTTCGGGTCAGCCGAGCTAGGTGGCTCGTGCTGCAGGTATGGCTTCAGCCGCCCGACG
TAAAAGGTCGGGTGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACAACGTGAACGGCCCGATGAAGCGCGCAGCGA
GCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAAACTAATGAACCCTTCTTGAATTCATTAGTGTTGCCCCTACC
AACATTGGCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGACAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGTAGTTGATCGCA
TCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGCGCCCTGCACAGACCCGTTCTTCTTCTTAT
TATTGCTCTTGGCGACGTCTGTGCCCTGCACAGACGCGTTCTTCTTCCTATTATTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTG
CGTTGCAGTCGTAGATCCTCCCCCAATTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTA
TGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCTGCCATTGGCAGGCACTCGCTCCAGTGTTAGAACGAGTGAGCGTAGCTCTTAAGCACGT
CTACGAGCACACGGCTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGATCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAAGCGGTCAAC
AAAGACAACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAGGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGAC
TGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCATGGACATACTTGCGCACCCATTTATACTGGTGGGCCCAGTAGA
AGTCTCGCGTGAGAAGAAGGTATGTCTTCTCGCGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGACCCTGAGTCGCAGGTCATGGTC
ATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGGTAACGGTGTGCACGAGCACGAAGATGCTTC
GGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACG
ACGTCGGGGTGCTCGATTGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAG
GCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAAATGTGCGGCGACTTCACAGCCGTCCGC
AACGACGCGTGGTCTGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGTTCGTTGCCAT
GTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGAT
TGCGAAGTCGGATGCGTCACACACAACGTGGAATGGACGATCTTGGTCGGCCACCGCCAAGATTGGCGCCTTAATCAAGCCCCGCTTGACTGCATCGAAG
GTCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACA
AGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTAACCTTCTCAGGGTCAGGGCGGACACC
GTTCTTCCCGACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGGGCTTGCGCATGAGCGCAAGC
AGCTTCCGGAGATGCACGTTGTGCATCTCAACATCGCTCATCCCGTCCCCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGC
GCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTTGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGAATGCCGCTCGG
CGTACTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGCGGATCTGATAGAATCCATCGCGCAGATCAAGAGCACTGGAGATAGTGCTCCTGGCCATC
GAGTCGATGATGACATCTTTTCGCGGTATCGGTGTCTGTGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAGCGATGCGCCAGCCGCCCTGTG
GCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGTTTTGCGACGACTTTCGAAGAAGTCGTCGATCGCTTTGAC
CTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCATGCCCGGCACGACATCAATCTCGTGCTGGATTCCCTTGTCCTCCGGAAGCTCCGCA
GGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGCAGGGACTCGTTTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCA
TCGACTTCGCACCGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAG
AATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGTGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGCA
TTAGCGAGGGCATCTCCCTGTACCGGAACCCGGCACAGGAACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGA
CATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCTCCATCTTCTTGTTTTGCGGAGCCCGACTCCGCTTGGTTTTTGA
CCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCCGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCG
CTTCGTCGTGCAGCCGGGCTGCATGACAGCATGCAAGTTTTTCCGGTGCGGAACGATTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGAGCCGA
CACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCGAATTCACCCAAGCCATCG
ACACCCGGAGTCGACGGCGTTACGTCACTTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATCCGCGTCAGCCTCCACGGCTGAGGCGTGTGACT
CATCTGCGTCATCCGGGCCCCTTGAGGTCGGAGACTCTTCCTGATTCGCTGAAATGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGT
CGGCGGCGACGCCGACGCTTCCTGCTCTTGCGAGCGTGCTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTAGGCGCAGTCTCGAGTGGGGAGTCG
CGCGCACCTGTCGGTGCGTGCGTAGCAGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGA
CCGGATCATGTCGAGCAAGCCACGGCATGCCCAATATAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTGTCGACATATTCTTGATCTTCATA
CGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAG
TCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCA
GGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTGGACACGCGG
AACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGATGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGT
GCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATCGGTAGCATCGCACATTGTTTCCTTGCGACTGCTGGGGTCCAGCAGTTGCAGC
ACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGACCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAAC
TCCTCCTGCATTGCAAGAGTCATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGATATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACG
TGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACAATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTG
CAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTGTGCGGGGTTGTCTGAACTCCTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGA
GTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCGACCTTCGACAACGAGTCGACGATGCGTCGAGCCGCAATGGC
AGTGTCGAGTTCGACAAGCCAACAGAGGAGAGGCTCGCCCTCTCTTCCAACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCC
GACGACACCGTTGTAGACGAAGCAGCATCTTGCTGCTCCCTCATGATGAATCCCAGAGCAACACCATGTTGCTCTGTCGGCTTTAGCGTACGCAGCATCG
TAGCTACAGCCGCCTCACCAATGACTGTTAACAGTCGTTGGAGAGCTTCCCACTCTGGGTCCGACAGATGGGGACAGTCAGCGCGTGCAACGTGAGTTGT
AGGCGTAGTGGAGCTTTCCATGGACACCTCCGTATCCATGGGAAGATTCTCCGCGTTCGTGCGCTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGA
CTACAAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTACGGGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAG
AGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAAATGAGAACTGCTATTTTTGTTTTATGT
TTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGTTATGCATGTCGCTCATTGGCTAAGAGATG
CTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCATTTGGTGTATCTACACCAAGGTCGAGGAA
GTCTTTCGAACCTCTAAC