Description :
From Genome Similarity Track
Location :
Scaffold_946:1397- 2540
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_946-abinit-gene-0.19AAR2 protein

Sequence
1143 bases(100 bases per row)
GAACGCGAGCTGGAACTCGCCTACGAGCTCTTGCCAGCGACCGCCGAACTCGTGGCTCAGCAGCTCCTCCAGCATTGCACTGTGCATCCAAGAAGCACAT
TGTCAGTTCGCTGGATTATCTACGATATAACAATGGCAACCAATTTCACATACCTCCGGTCAAAATGGTACTGCGTTCGCTCGACTGCTGACAGCGGCGC
GCTGTTCTGCTTGCGTTTTGGCAGCAGCGGCGTGAAGCGCACGGTGCGCGGAAGGTCGGGGAAGAATGGCGTCATGCTCGCCTGCGCCTCTTTCTGCGCC
GTGTCCGAGAGGAGATCCGAGTCGCCAGGAAGGATCAGCGCGCCAAGCTCAACGCCACATCGCTGCAAGTCACAGAGGAACCTCAGGTTAGGATGGACGG
CTCTCCTTTGCAAACGGTGAGTTGTAAATGGGAAGACATGGAAAACCTTACCTGCAGCACCGAGCTGGAGATGTACTTGGTCATGCGCGTCCAGATCTTG
TGGTGTTGCTTCGGATACACGCCGAGTCCGCTGTCCAGTTGGAATGAAAGCACTGCGTCTAAACGAAGCCAACGAACAACGCAACGGCTAGTACTGCTAG
CACAACAAAGCGACATGCACACATACATATAGACAGACAACAAGGCCACGTACGCTCGAGATGCTCCACGTTGAGTTCGGGGCGGGGCGGCCCCAGCTCT
TCCTTCTCGGCGCTCCATTCGCGCACGATCACCTGCGAATGGCGCTCCACGCGCACGAAGAAGCCCTGGCGGATGCCATGTTCCTGCTCGCGCGAGCGGA
ACACCACGAAGTGGATCCCGATCGGCAGGAACTTGACGCCCTGGAACTTGGGTCCCGTGCGGAAGACCTCGTAGTCCACACCGAACTCGGTGTCTTGCGG
CACGTCCAGACACACGAGGAAGCCACCGATTGCGCTGCTGCTGCCGCCGATGGCATCGCTACTGCTGGTGCTGTTACTACTGGTGCTGCTGCTGGTGGAT
GCGCCAGCTGCTGGCGTCTCACCGCCGCGCAGCGCACGTGCAAAGATGCCCGCAGTGGTGGTGGAGATGTTCGCGTCCATGGCTTTTTTGAAGTGTTTTT
TGTTGTTTTGAAAATAACAACCCGTCGTTATTGCAAATTGGAT