Description :
From Genome Similarity Track
Location :
contig_30:139697- 141635
Transcript NameFunction/comments
g6540.t1XP_009538757.1 hypothetical protein PHYSODRAFT_307593 [Phytophthora sojae
g6541.t1hypothetical protein

Sequence
1938 bases(100 bases per row)
TCCACCAATCACGTCCATACCCTTTACAAACCGATATCATGTATTTTGAAAGGTAACATGAGTGAATGCGAATCGACAGTCGCGTGATTTTAGGAACGAG
CCATCAGTGCAAATTGCAAAGCACTTCTCAATTTGCGCAACACTGGATAAGATTCTCTCCATGACTGCAGCTTCTCCGACGCCTCTGCTGCTGGACGGCA
AGGCCACGAGCGACGTGGTCCGTACGCAGCAGCTCAAGCCGCAGTGCGAGGCGTTCCAGAAGAGCCACGGCCGCCCTGTGGGCCTCGCCGTGGTGGTTGT
GGGCGCCCGCAAGGACTCGGCCACATACGTGCGCATGAAGCAGAAGGCGTGCAGCGCCGCGGGCATCGCGTCCTGGAAGATGCGGATCTCACTAGAGCAG
GACGGTAACGAGAAGCCCGCGGAGAAGGTGACGGCGGAGCTGCTGGCGACCATCCAGACGCTCAACGAGCGCGCGGACGTCGACGGCGTCATCGTGCAGT
TGCCGCTGCCCTCGTTCTGCGACGAGGACGCCATCCTGGCCACCATTGACCCCACGAAGGACGTGGATGGACTGCACCCGGACAGTCACGCGGCGCTCTT
CCAGTTCGCCACCAAGAAGACCTCGTCTCAGCACGACGAGGCGCCGTTCAGTTTGCCCTGCACGCCTGCGGGTTGCATGGAGCTGCTGGACCATTACAAC
ATCCCGCTGGAAGGCAAGCACGTGGTCGTGCTCGGTCGTAGCCAGGTCGTGGGCCTGCCTGTGTCGTTGCTGTGTCTGCACCGCAACGCCACGGTCACCA
TGTGCCACTCGCGTACGCAGGACCTGAAGGCGCGTGTGCTTGAGGCCGACATTGTCATTGCGGCTATTGGACGACCGCGCTTCGTGCAAGGCGACTGGAT
CAAACGCGGCGCCACGGTGATCGATGTGGGCATTAACCCCGTGGAAGACGCCTCGAAGAAGAGTGGCTACCGTCTCGTGGGCGACGTGGACTTTGACGGT
GCAGTTAAGGTCGTGCATGCCATCACTCCTGTGCCAGGCGGCGTTGGCCCCATGACTGTGGCCATGCTCCTGAAAAACACTATCCAGTGCGCAAAACGAC
GCGTGCAAAAGCAGTAAAACACAGAGGATACGAGCGACGGAATCCATTCAACGCTTCCTAAAGTTTGGAGACTCACCCTGGCCCAGCAAGCGAACAAATC
GACTTTGCCCGGCTTCGGCTGCTAATCCTAGTTGGTAAGGCGACAATTGTAAGTAAAGCGTTCCCTGACCCCGTTCACTGCCTGTACGGGCCCGCTAGAA
ATCGTCGTGATGACCGAAGAGCAAGTCCTCCTCGTCCTCTGACGAGAACTGCCCGCTTTCTTCTACGAGCTGCACGTCTTGGTGCAGTTCCTCCCAATAT
CCTCCGTGTGATTGCTGAGCTAGAGGGGCTCCTGTTGCCGCTTCATTATCGCCGTCTGCAATCTCCAGGTTAGTGTCCTCATCGTTGTCGGCAGCTTGCT
TCTCGTGGAGATGGTTCACAGCTTCCTCCAATCGTTGCAGTGCCGTCTTCGCACTAGCAGGACGAGCTAATGCGGGTTGTTGCTGATGCTGCTCCTTCGA
TTCACCTGTAGATGCAGCTCCGAATCTCCGTTGGCCCTGAAGCAGTAGTCGCATGCAATCAAGTTGACCATACGCCGCAGCGATCTGTGCCGGAGTCTCC
CAATCACTGTTCACAAGTGTTGGGTCTGCACCAAGTGACAGCAAATTCTGTGCCACCGCTGCGCGACCAGAAAATGCTGCCCAGTGCAGTGGGGTATCAC
GTCTTTCGTCGGCGGCGTTCAAGTTTGCTCCGTGCTGCACTAGTCGAGCAATGATCGAGAGAGCAGCAGGCGATTCTACCGCGTAGTGCACTGGAGACCG
ATGCAAGTCATCAAAAGCGTTGGCGTTCGAACCTCCGC