Description :
From Genome Similarity Track
Location :
Scaffold_69:139627- 142315
Transcript NameFunction/comments
Hyaar_Emoy2807777AlNc14C11G1374
Hyaar_Emoy2807778PREDICTED: transcription factor HBP-1a-like isoform 2

Sequence
2688 bases(100 bases per row)
ATGGCATTACTAACTGCAATCCTGTAAATGAAATTGTTTTGACAATAGGCACCTGTACCGTACTTTATCGGACTACATACAAGCTCATTAGCTACTCAGG
TGGGGGCAGAAATGTTTGCATCGTGTGTCGTCGTACACTTGGATAAAGATAAAGTTGTATCTCCGATTTCCTCCCGAGTCGAAGATTCGTTTGTAGAATG
GATCCTACCCCGATTACCCGCAACTGAAGTAGCGGCCGTCCTGGATTTGCTTGAAAATGTCGTCCCAAGTCCTATCGGACACACCTCTCCTCACTTGCAT
CCTACTCCAGAATGTCACCGATCTGCTTCCGACGCAGTCAACGAGGTCGAATTGATATTTGGTGAGGGACCGGTACGTACCCATCTATTAGACATAGTAG
GAAGAAAGGGATCCCTGATTGAATGTAATGTGCTTGCCTCAAGCTTGGGATCACGTTCGAGTCGACGCATCTTCGTCTTCTAGCGGCCAGCAACTTTGAT
TCCAAGCGCCAGCTGGGTGGGTCTGCAGTCGTGAAGTCGCTGCCCAGGCTGCTGAATGGACTTGCAGGTCCAGCAGAGTATTCGGGGCTGATATCCGCTG
GGAGTTATCTGATCGGTATTAATGGTCATTCCACGCTGGACCTGACGTTTGAGGAGACTATCAATTACTTGCAATGTGCAAGCCGTCCAATCCGCTTGCG
GTTCTTGAATGCGACACTTCCTTACAAGAACGCTTGCAATTTTGCTGACCGACTGCAAGCTTTGTCGCTGGTGTCAGCTATGCAGACCACGTTGGAGAAT
TACTCGCTACCGTGGGTGGATACGCTGCGTGGAGCCTTTGCTGCTATGTTTGCGAGCATATGCCGTGACTATCAACGCTTTGTTAACAGTCACGGTCAGG
AACCCGATACTTACATTGGTGGCAGACAGCATGCGCTTCCGACAGGCGAAGACTACGATCGCATACGACGCTGTTCTTCAGCGCCTTCTTCGTTTACGCA
GTTTGACCACGAGTCTTTTTGTGACGCGGTGCCCTCGAATCGGAGATTCCTGCTCGAGTTCACTCAGACACAATGTTTCGCCAATTTTGTGAACGAGAGC
ATTTTCGACATGCAACCGGTAGCTGGATCCACTTCGTATGCGCTTTTTCATGAGTGTATACATCTCATTCGCGAGTCCAGCAATGCGAGGGCGGCTATCG
TGCTTTTGTTTGAGCGGGATGGTTCACCAACGGAGACAGCAGTGATCAATTTGTCTTAGTGACATGACCAGAAGGCAATCATGGCGTGAGAGAGAAGCCT
TTAGTAACTGTCTTTGCGAGGATAGCGAAGCAAACTACTCCAGCAAGCCCAATTTAAGCTTTGGGTGCATGTGGTGGAGCTCGGCGAACATTGTCGTCAT
CTTTTTCTCGTTCTCGCCAAATGTGGAAGTGAAAAATACGCTTGGACTGGTAGAGTTGTCTGAATGGAATCCGCTAGAGCAGCTCACGGTCGATATGTTG
CTTGGAATATGGGCGTCCACGATTGAAACTCCAGCTTGTGTTTACACTTTCACCGTCAACACTCTTTGACCGGATCAAGTTGATCAAAGAAGTGGCCCTA
ATGATCTCCAAGTTCAGGTTGTAGTCCTCATACATTTATTTCGATTCTACCATACCGTTGACAAGTGAGCAGTCCGAGCAACAGAGCAATGCATATCATT
ACTCTTTGGGGCAGCATGACAACTTTTACGCGGAGATTTGCAAGGCGGACTAATTTGGAAGCACTCCAGACAAAAGCCTTACTGCCTGCTGCTTTCATGC
ATGAGGCTGCTAGAGGCTTCAATATGACTTGACGTTTCTATGCGTGACCACACTTGTTCACACCCCGCCTAGCGTGACTTTCGCACAGCCGATACAGCAG
CATGATGGCAACGAGAGACAGCACGTTTAGCAACACGCCAAAGACCAGCTCGGACGACGTTATCTCATGCCACCAAGACCCCACAGTAGTCTCCACCAAC
GCCACTAGTGACTTTGACGCTTCCAACGAGCACTTTGCCATACCACATGACTTCGAAGACTCGTGCAGCACGCGGCCAACACCGCGAATGGTGCCAGCAT
CGACGGCATCGCCATCGTAGCTGGTGAAAACAGTGACTCCAAACACGGACGCGCACACTGTCAGACTCGCTGTGGTGGACAGCGTGGACGCCACGGCACG
CCGTTTGCCTGGTCGAGGCGTCAGTATCGTCATGTCCGAAACTTGTGTGTCTCCTCCAATCTCGTCGCTGTCCGTCTTTTTCCGGCCATTCTCCAGCACG
TGAAGCGCCACTCTGCTCTGATCCATTGCCAGTGGTGACGAGAGCAGCAGCGAGGCGGCAGCATCCAACGGGTCCTCCTTTCGAGAAGACGATTCTTGTT
TGCAACTGATTACCAATGAGCGCAAGAACGCGTTCTGGTCCAGCAGCGACTTGTTCTCAGCTCGCAGACCAGCAACAACGGTCTGTAGCCCCAGCTCCTT
CTTCTTCAGCTCGGCCACGTCCGTCATGAGCGTGGGCAGCCGCGCATTGCGGCGCAAGCGGCTCTTGTTGGCGCTTTCTCGGTTTTTCATCTGACGGATC
GCTCGCTTGGTCTTCACTGCAGTCGCGTCGTCACTGTCCATTGCAGTCGCTCTAGTGGCAGTAGCAGACGACGTGGTGATGGGAAACG