Description :
From Genome Similarity Track
Location :
Scaffold_1306:1396- 2417
Transcript NameFunction/comments
g15375.t1hypothetical protein

Sequence
1021 bases(100 bases per row)
GTACACTATGTTCGCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCCATCTCGACGTAACCCTCGATATGGCCACATACAGCTG
ACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGA
AACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGG
CCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGAT
GATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTCGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCA
TCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCCGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGA
GGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGC
TCCCGGTCGGATCTTCTCGTCATCATCTGGATCACCGACGGGTTGTCGATGAGCATGTCACGTGGAATCTTGATGTAGTCATTTCCCAGATCATTGTGTA
CCTCGTGTCTCCCCTCTCCAACCTTCAACAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTC
TGTCAGACGCACCTTCTGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGATCCGCCCTTCACCACCTGCAGAATT
TGCCTGGAATCTCCCTGAAAC