Description :
From Genome Similarity Track
Location :
Scaffold_28:13957- 15095
Sequence
1138 bases(100 bases per row)
GCCAAGCTCTTCTAGCCATGCTCGTTCAACGCACgTGCGCTCTGGTACTACTTGCGGCTGCCATCGCTTCACACAACGCTGCAGCTCAGAACCCCTTGCG
GAGACATGAATGATTTCACGTTTGAAGACCTGACAACAAGTATTGATGTCGGTAAAACGGTGACAACTATGtCAACACCCTGTCCAACAAAcAGTAACTC
TCAGGTGCAAAGCGACTACTACGGCGGCGTGGTTGGTCAGCTACCACTCAAGGAGATGAAGCCATCGGAGATGCCGCGGCCTTCGGAGCAGCCAAAGCCA
TCGGAGCtGCCTGAGCCTGTGCCATCGACCCGGCCATCAGAGCAGCCGAACAACCCCCCcccTTACAGTGATCGGcGACAGCCACCTCGTCTTACGCCAG
CTTGCGCACTACCGACTCCCACTCTCGGCGCGCCTTCGGCCGCTCTACACTGAAGCACGGCTCATAGCAGATCGCCTCAACATCGTCGCGTGGCGTCACC
ACCTACACGCCTACAACGAGATGGtcGAtcTGCagCCAATGTCgCGATGAACTCCAAGTGCAGTttCCAGACATTCCACCCGTCCGATCGCCGCGAATGG
CACTGACTCGACTCCTTTCTCCAAGGTGACATCGCCcAGTGGAGGGCTTCCTCCCTCCTCTAGCCAGCCGGCCATCCCGGCATGCATGTTCTTatGTTCT
ATCATACCGCTATCGTAGTTCACACCAGTGTAACACAATAGACGCCAACTTTGtCAGTCAGTCAGAGCAACCAAAGCCGACGGAGCAGcCAAAGATTACG
GTGGAGCCATCTGAGCAACCAaTGCCAccTCAGAGCAGCCAAAGCCGACGGAGCAACCTCAGCCTGTGCCATCAGCCCAGTTGTCGTATTTTGCCACAGC
AGTCTGAGCTACAGGGAACCGAGACTCCGTGCCcGACCTCGGGTTAGAACGCTGGAATGAcTAGTgaGGCAGTTTGCCCTTACACAGACTGCAGTTCACC
CAAGATAACATTTACTTTTtAGGTGTATCAAAAaaaTCCATGTCTGTGTTTTTACCtCCCAGTAGTGTACCCTCATTAGGGTTGTGTGTCTTTTtCTAGA
TTTTGGTCCTCACTTCCAGAAAAATACAGATAAATTTC