Description :
From Genome Similarity Track
Location :
Scaffold_143:13954- 15368
Transcript NameFunction/comments
g8414.t1hypothetical protein
g8415.t1hypothetical protein

Sequence
1414 bases(100 bases per row)
AAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCT
CCCACTCTGGTTCCGACAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTC
TCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTA
AGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAAAGAA
CCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGG
CTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGT
GGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTGGGAGGTGAACCGAATGTGTAGCCCCGCTACACTACCTATCTAGAGAAAAAACTTGCAA
ACCGGCGACCATGTCGATATGGTAAGTGTAACCCGCGCCTCACAGAGGTATTCCTCGACGAGTCATTCTGCAACGTAAACTACGTTTCGGGAAAGACGTG
GGTTCTCGAAGACAGAATTCGCTACAACAAGAGCGGCAAAGGAGCGCGGTACGTTGTTTTTTTTTAAAGTAAATAACGTGAGTTCAATTTTGCTAACTTT
ATTATTGCAATTTACTAAAACAAATTGTTAGTGCTTGTATAATTGCTGCAGGCTTTGTTTTTCGTTCGTAGGCGGACGGGTGGAGGCTGGCTTTGTTAAG
AATTCAATTAAATGCTGGAACTCCACGCTGAGAAGAAAAAAAGACGAGCTCGATGAGGACGTGGACTATCACGGCAACTTTGACACAGAGGCGGTGTCGG
CTGTTTTTAGCTATGGGTCACAACCTGAGTCACCATACAAAACTCAGGCTCTTTGTGACCTGTCAGCGATACATATGTTAGGAGGTTAGGGGAAAGGGTA
ACCAATCAAAAAGTGTGATATTGTGTGAAATCGTGTTACTGATGGCACATTTCAAATCGTGTGAATCCATGTGACACTACAAACGTTAAATCGTGTGAAA
GTGTGTTACCTGCGCCGTGCGGCACGACTTCTTAGTGCGCTACTTGCCGGTCGTGCGGCGCGTCTTCTTCCCAGTCGCCGCCGCCTTCTTCCCCGTCGTT
GCTGCCTTCTTGTC