Description :
From Genome Similarity Track
Location :
Scaffold_29:139533- 144349
Transcript NameFunction/comments
Phyca_LT1534115854sedoheptulokinase putative

Sequence
4816 bases(100 bases per row)
caccttgccgttctgccggcatccagctccagctccagctccagcctccatcctccagcttcagcatccagccccacatccacctccagcctccgtccac
ctccagcaccagcctccgtccacctccagttccagcctccgtccacctccagcctctgccccgtctccagcctccgcctcgcctccagcgtccgtcccgc
ctccatcctccgtcccgcctccagcctctaagcacctgcgtccagtgcccaccttcagcgcctgtccagcctccgtgcgcgcaagctccagtcccctctc
cgccgcactcaagactcccctcccctccaccgcagattgtattttgactatgtaaataaatgtggcatacagcattattctagatattaatactatttgg
tttcagagttatcttgatatgtatgtaccaacattttggtacggtcggagcaagtcggaggtcggagattttatggtatgattgatgggcaactgctcag
cggctcccacataatttctggagctcgtaacggcagttagagtattttgcttaagttgaaaagtaccgctaaatgcataatgtccgggaccttcatggaa
ccccgggagagtttctgtgtgttgatgggtgttgggttggtgaagggacgaacgaaaacgattccatgtgctccgtagatccgaaatgaagttattctgg
gcctccatcgaagcagaagatgcgtccagagaagatgctgcgtaaaatgatcctgagcttccatccaaaccgaaacgcgagttttcatgagtgtaggggt
ttagtcagtagtcgttgggagtgtccgacgcgtccatgactgtcaaatattgactattatccggtggaaccgctagttgactttccctgatggcattacc
aacgtaagtaggaggtgctatcactccctggaatgtggccgtgttttctgaagcccatcgagtctcaaaaccgccgccacaaatgtgttccagttccgcc
tcctgtacggagtacgatgaaatttctggtactagcacagaatcattggccacatcgccaattatttgtcttttctgcctttttctagcccgtctgcaca
taagtttatctccaaaccccacgtcttcatcataaccaagaacctttcttgccaccactaacgtgagagaaaattacaaacttgcaaaagttagtataag
ttaaagtgaaatgtactgaaacaaaagttttacctttgcgatgttctctgctgcaatcgttcaagcgctcgccgggactgcggtgaagctttcccttcgc
tgtactggttaagccatgctgggtagctctcctcgatgaagccgatcattatggacgtagtgagccactacaagagcacataacttagaaacctatagaa
acatgcaaaaatcaaaacattacgcacctcttcgttacgcctggtgtccttcatgaaggtaacaagagcaggggtgaagggaaaactctccttacgcccc
tgccctttcgtcgtcttggccagcttgttcccagtgaacgcgtgaagcctctcccgctgccgccaccagctatccacggtaccatgagggtacctgagct
cgtcgacggcagcggtcaagccgacctggtcaatgcggtccagcgcctctagcttgagcttcacgctgtaactgtgctgttttcaaggcatctttagcaa
tggtaggggcaagttggtcggtaacgttagctgcaatttttaagtttttttattggtaaataaataagttgatttttcaatttgattggtcaaaataatg
tgatttttctcgtgtacccgagttttttgttctccgaatttttgtgactcgatctctcacagcacaaaattctgcgtagtttgtcgtgtagtgtatgtcc
atgatacccgtgaataccgctacaccaggtttcgtcgctaaatgccttgttcgtttgtgtacgttgtagagaacgtgaaaaaagcacatcagatacttgc
attcgctaaatgcagaaacactccgaacagcattaaactgagcatcttccgcgtcgcctaagacaacatcaacacgaagtgttgtgccatatacgtcgcg
atacacgtttgccacgcatccgagagcgagtttgtactctcgatgggttcttgcgctcacgaccaatatggcagcaaggtgatatgtccgcgccctatcc
gtgaacccgcaagttaaaacagggtagcctagatcactaagcttgaatgttgcgtcgacatggaatagacgaaagtgttcctcgcctctaagctggtgaa
ttttagagagcagtccaagtgttgttatgcccaggacgaatggatcctcgtccgatcctcttccaattcgtggatgcccgtcgtcatcagcttctggacc
aaaaagaaaagccttttcggcatccatccatcgtaaatgaataatccatcgttaacattttcacagcttgcctggtatttcgcgaaagttttttttttcg
tagccacttaacgcaatccgcaatttgttggcgcgatggtagacctagtggaggtgtcggtacgcccggcgcacgtcgcaaactactccaaatatgacga
ggaggtattccacaatcatccattcgtgtcacgtatgccttgacgtcatcggtggtaggacgtcgatgttttccgctacatatctcttcagctggtgata
gtgaatcatctgggaacggatttggagaatcttcaatgaagatacatatatgcatggattccattcggggcatatctatacggtacaggtggttttgata
tgggatgagaagaaccatatgtgctagagagacttgcaagccctccagcctctccgctctccgacagaggtactagaagaagaaggcgatgcagaagaca
tcaacgcagaaacagttctacaatctgcacctgctccgtcaatagcgcttggaaactccacaaatgaagatgaccacgacaaacgcggtaggaattgagt
gttacaacatcccagtatttttctctgacaactctctttttggtgaaggaggaatgctacgccgtgtaagccatgcatcaagtactgccctcactgagat
gttaaacgatatgggccctgaagaagatattaacgaagctctcgctggaataaggcccctcgcaagagatgccgaacctaattaccaggtgccacagaga
tgttggcttgctgaaggaggccaatgaagaaccaatgcaccggtcaaatgctcgagaatacataggtgcggttcaacgtcgactctttataattatttgg
tggacattctatttttttattggagtgcaaacgctgtttttttgggtgagttttcttttcgtttttggtgtcgatacaccgccctctgaatatttaccaa
ctaaaattgtggcagggcgtggtgaaagactgtttaccctggttttggatcaaattgatgacgtgagctccgtccggaacaaaatggcgttcaaatttgt
ggcaatgacgcaggttggtggaactccgagctgacaattcagtttcttctttttaattttctttggcgcgaggatatggttttacttattcagggtcatt
ttggaaataatacgatcattttgtgtcacttttaatttttcatccccctatttggaatataaattattgttttcctctaataatactggcggaataaaca
attgcatcacatctttattgcgttgtagggcacaggggttccgaatattgaatttatatggattgcgccgtgctactataaatccgtaatgcactggtaa
aacaagctgtaagaaatcaataattgatacgaggagagcgaatcaatacgtaattgctgagagtagctgcatttccttttaccgtagcagtctcgtcggc
caaatagacttacacatacctgtcaacaacttcaacatcccagtacgaagtgttgaccttgaggaagagcagcatttccacagctagtggtgaaagggct
tggcgttcatgtccgatcatggctcggccacgctgaaagacgctccactctgttggaagtcgtcggaattgcgctcaccagagggtaagacgccacagat
ggctttaccttgcgcttttttagaatgcgctcaacaaaaccctccttagcgccacggcttgtggctcgcactctgccccttgcaaaaagggccgtaaagc
ggttttctcgtcacgcaacaattcagttgcatcaccagctagaatcttgcagcatccagactcgaatgcaggggagtgaataatattcgcagatgctcct
acaaaaagtaaacaaaatgtaagcacaatggttttcgtcagatgagcataaatacttaccaatgtaggattttagaatgggcttaactgcaataagccca
tcctgtaggtcgcgcgcccctagaagatcaacgtcgttgctttgcagcgcaagagaaacggactcgcagtccgaaagctcgttcaagagggctttgagtc
ggctgtgggttgccggcgatggcagaaactccaccaattcatcgtcatccatggacaaaaagccacgtaattcaaagtaccgacgcagcatggcatgcgt
tgagccccaacgcgtctcttgacgaagtacgggtcgaagcggcgtcgccagcctaaaaaaaattaattagaaacaattttacttaaaatagcggaataaa
tgtacctgagcttggcaccttcactgcgtgtcttgagtttcttcatcagacgttggacttcgcagaggtcggcctcgtagggggccaaaaacgcctttaa
cgccaagttcaagcgg