Description :
From Genome Similarity Track
Location :
contig_200:13950- 16852
Sequence
2902 bases(100 bases per row)
CCATCTTGTCTCCGATCGCGCAATTCTGATTGTGCCTCTGCGGTTCGCAGAGGTTGCTGCTCGTCGCCGTTGAGACCATCCCGTTGACGCCGCGTTCTCG
CCGTTTCCCAGTTTTCTTTTCTTTCAGTTTTCTTTGCTCGCACTCACGGAAGCGTGAGTGCAACCTTAAGAGGGGGGTGATGTAATGGGCCCCTCCCATT
TACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGAGACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCATCCTGCGATTGGTTGAAAGTG
GGGAGCCAGACCCATTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCCCCGGTCCCAATAATAAACCAGAG
TTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTGGC
CCGTTACATATCATCCAGATGAACTCCAATTTTTTTCGCGAGTTCGATCAAGATCATGATCGGATGTGATCGGCTTGATAAGGCTGCTCATAATATTTAA
TTTCGTGCAAACTATATTAGGAAACATATACAATCAACGATGAGTGAAACTCAACTATCCGACCAATATTTGTACCAGAGCTCGCTCAAGAGCGATCCGG
AGATCAAGGTATCTTCTGACAAGCGAGTACCGTTTGTAATCGATCTTAATCAGGGATCGTATCAGAATGGTGTTATTACTATCGATGCCTGCTCAGCTTA
ACGGATCCGAAGGATTTGCTTGCCTTCGCGATGCGTACATCATGCTCCATACAAGGTATCAATGAAGAATGGTGCTACTGCTCAGACTGCTGCTGCTAAT
CGTTTCTGCGCTACTCTAAAGTGTGGCAACTGGAATGTCATTGATAGCATGTCTCTTGAACTAAATGGTAAGACCATTGTTTCTATGGCTGACTACAAGC
TCTTTTGGAACAATGTCCGCGCGCAGACAAGCTACAGCACACAGTACGTTGAGAAGCATGGAGCAGAGTCGTTCCTTTACTCGGATGCTGCTCAGTCCGC
TTTGTACAGTTCTGGTACCAGCTCGACTACTGGAGATGGATACTCAAACAATACTGCATTCTCGTCTTCGTTTGCCACCACTGGCCCTTCGGGTGGTGCA
TCCATTCCAAACGATGGCTTTGTTCGCCGACTTCTGTCGAACCCTCCTAATGCGGTTCTGATTTCTCTACGTCGTGGCCGTCGGTAGGTGGAGCTGCCGC
GTCTACCACTATCTCGAATCAGACTGCTCGTGGTACCTTCGTAGCTGGTGCTACTACCGCTAACGCCATCATGGGAACGTGGAACTATATGCTTAAGATT
AAGCTAACTGACCTCCATCCGGTTTTCAAGGAGCTCGACTTGATGGCTAACCCCAGATCCGTCTCCGTTTCCGTGTCAACCAGGGTACTTCGTCTGTTGC
TGTAGATGTATGTCGCTAACCAGTACTACTCTCGCGAGTGGCAACACCTGTCCGGTAATGGTTTCAGCTTCTTCGACTGGTAATCCTATGGCTGGTGTTC
TTGCTGCTTCTGCTCCATTCAGCATTTCTTGGGGTGCTGTAGTCAATGCACTTGAACCGACCATCGATGGTACTTACATGCCATTTACTACTTCTCGTAT
GTACCGTTCGTTCATCTCGAGAACCCTCAGGCAATTATTTCTAAGCCTGTTAAGAAGGTTCGATACAATGATTGTTATGCACAGTGGTTTTACCAACGCG
CTGGTACTGGTAAGCAGTCGACTCAGCTTAATGCTGCATTTGATCTCCAGCTATCGGCGTCTGTTAAGAATGCTAAGTATATTATCCTCCTTCCATTTGC
TGAGCAGACGGGTAGTTTTGCTTCTGCTGCTGTACAGGAGTTCCAGAGTCCGTTTGATTCGGCTCCTTGAACTCTTCACCCCGTTCGAGCATTCGCAACT
TTAACGTTCGTATTGGTTCTCAGCAGACGTTTGACATCAGCCACGACTATGACTTCCACCACTTCACTAACGAAGTCGCTAAGATTGCTTCGATTAACGG
TGATCTGACTCCTGAGCTGGTGAATGGTCTTCTTGACTATCAGACGTGGTCGCTAACTAACGTGTTCTCATTGCTGATGTTAGCCGCCTGACGGAACGTG
ATGTACCCCAGGCTATTCAGGTAAGCGGTGTTAATGCTGGTTGTCAAGGTACCAACATGCTTGTGTTGATTGTGAGTGAACAAGAGCTCTCCTACGATCG
TCTAACGGGTGAGGTATTTGATTTTACCACTACTTAGTTTTGGATTGAAAAAAAATACTTTTTTTTTAATTAAGCTCTAAAGCCTCTACAAGCTTAGGAC
ATTTCTCAATTACGAATGGTTCTTACGAAGCCAATCAATATAATTAGAATCGGTGCGACTAATTTGCTTTAGCGTCTTCCCCTTGTACTTGCCCCAACTC
ATCATATACGAATTATCATTGCTTAGAAACTTGGAGTGAAGGAAAATCTTGATATCCCAGTAATATCGAGACTGGGTTGGTTGTGCATCCATCGACAATA
ACCGGGATCAGAAGAATAAACTTCTTCGATCGGCGCGCCCTTGTATTTTCCAAAAGTTAGTTCGAACGTCATGTTATCAGTTGGTGGTATCTATATACAT
ACCCCTTTAATTTTTTAGGGAAAAAAAATTATGTAGATTGCTTACCATTTACTATAATCCGGACCCCACCACTCAAGATCTTGCGGATGTGGCATTGTCT
TTATCCACTTCGAATGCTTTTCTTTATTACAGTGTTTGCAAAGTTCCATCTCTCCATTGATGATCCACACAAGCAAGTGATTCTTTCATTCATCGGTGCT
GA