Description :
From Genome Similarity Track
Location :
Scaffold_1339:1395- 5225
Transcript NameFunction/comments
Phyra_86864HECT E3 ubiquitin ligase, putative
Phyra_72466HECT E3 ubiquitin ligase, putative

Sequence
3830 bases(100 bases per row)
AGCACAGAGTGGAGGTTCGTAAGGGGATAATGGCGAGGGACTCCATAGAGTCCTCGAACACATTGGCACGCTCCACATTAAGCCTCAAATGCTCTCTCTC
CGCTGGAACCAAGAGTGTTGACGTGGCGGTAACGAAATGCGCATACTTCGAGGGGAAGTCTTTGCTTGCGAGAGCTATAGTCTCGCTCGGCGGCGGCGAT
GTCGTTGTGGTCTCACGTAAGCTGCTATTTGGCGCATTTAATTCTGCGCTTCGAGGTCCAATCTCAATTTCCAGGGGCAGTTTCGAAGCGTCCACAGTGG
TGTCAGAGGCTGTCGTGAGTACTGTGTGCGTTGCTTGGGAATTGTGTACCAAGTTGGTAATGCATTCTTCCACAGATCCGAGCAATGGTTCCTGCTCTCG
TATGCTGTCCGGTCCAAGCGTATTCGCGTTCTCTGCTGCAGCCAGTTCGTGTTCTGGTTCGGGTTCGGCCGCATCCGTTCCAACAGAAGATGCCGTTTCC
GTATTGTCAAAGGCAATTCGTGATGGTGCAGCCGGTAGCAGTGGTGAGCCATTATCTCTAAGAAGGACAGTTGATAGCTCTTCCGACACGGATTCTTTAT
CACCTTCACACGTCGTCGCTCCTTGTTGAAGCAATGGCAAAGCATCAATCCCATTGGACTCACCACAAGTAGACAGGAACTTGACAACAAATCCCGTGAA
TCGCGTGTCCGTCCATCGTCCATCACGGAACCAGAACGTGCGTCCTTCAACGTCCACTTTCCTCGTCCACTCTTTGCGTCGCTGTGCCCGTAGTCGACGT
CGAGTCGTTTGGTGCGTCGGCGTAGCCGTGACCAACTGCACGCGACTCTCTCGCTTGAACAGCGGCAAGAACGATAGTCTCGGTGCCTTCTTGTCTCCGT
TTTGCTGTTCGTCGTCCGCGAGCGCCTGTCCGCACACGGTGCAGAACTTGACACGTCTGAAGTTCTCGAAGCTGCAGACTGCGCAAACGTTGAATCCCTC
CTCCGCGTCTCTCAGTGCCGCGTCCAGTCGTCGATCGTCAGAGCTGCAGCAATTGCAAAGTTAGTGTAACTGGGGCCTCAACGGAAGAGCAACGACGCAC
TTGAGCAGCGGCGCGTGCAGCTCCAGCGACCGCTGGCGACGGATGTAGGCGCGTCTCGCTAACAGCGACAAGCAGCAGAAGAGCAGCGCGATGACTGCCA
GCACAGCGAGGAAGCCCACCACGGCCTGCATGTCGTCTCCGGATGAATCTGAGTGTGGCGTGCGTCAAGCATCTGCGATCGATTACCGAACTGGTAGATG
CAAAAGTGTTTGTCATGGGTATAGTTTAGATAGATTATAAGAAATGAATAAAGAGGAGAGGAGAGACTTTTGAGGAGTACTGTTGTGTCCAGGTAGCGGT
ACAGCAGATGAGTGTTGAGCTGCGGGCACCGTACACCGAACGCCGACCGTGCTGATCAACAGGATGTTGCTACATGGCAGGAGCTAGGAAGGCACAGGGC
AATGTATATCGCACTCACTTACTTAATATCACTCTAGTCTGCACCCAATAAACTTCACTAATCGGTTGTAAACCCGTACACCTCGGTCTCCAGCACCGCG
TACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCACCAATCAGCGACA
CGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGAAAACTGCAGCAG
CCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTTGTGTTGCGCTCC
CAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGATTTCGTACAGGC
CCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTTGTTGGAATCGGTGACGGGAAT
GGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGCGCATCGACATTGTCGTTCTCC
AGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTAGCCCAGGATCAGCTTCAAAAACGGCGAGGCCA
AGTGGAAGCACAGCATAGAGCCCTCCAGGAGTGCACGTCCCAAGAGACGACCAGCCGCGAAGAGATTTAGCAGCTGGTTAGGAAGTAGTTCCATATCCGA
GCAGGGGCTCATGTAGTATGTCTGATCACGCTTGTTAGCACAAACAAAGAGCCCACGTACTGGATCCACAAGCGCCTCATTGAGCATCACAAACCACTCA
CGTTGAAGACCCCCAGCGTCCACACCGTTCTCATCGAGGAAGTTTATGCGCACTACAGAACGAGCATTCTGGAGCGGGATGATAGCGAGGGACTCCATCG
AGTCTTTGAACACGCTGGCACGCTCAACGTTGAGCCGTAGATGCTCTCTTTCAGCTGGAACCAGTAGGGCTGAAGCAGCCATGACGAAATGTGCATACTT
GGAGGGAAAATCTTTACTAGCGAGCGCCATTGCCAGGGGTGGTGGTGATGCATTGCCTAGGACAGTATCGGTTCCCAATGCTGTACGAATTGGACTGTTC
GGCAGAGTGAGAGGAAGTCTTGTGGCATCCATATCAGCGTCAGCTGCTGATGTGAACACAGAGTGCATCTCCTGTGCGTAGTTTACCAAGCTTGCAGCGC
ACTCCGCAACCGATCTGACCATAGGTCTTGGCGACATTGCTCGATTTGCCGCATATTCTTTGTTTCCCTCGGTGTGTTCTAGTTCGGGATCTGGTTCTGA
GCTACTCCGGCTCGTTGAAGCATGAGCTTCAGGTGATTTTCCGTCCACGGCAATTCGACTGTTTGCAGGCTTGAACTCAACAACAAAGCCTGTTGCAGGT
GTATCAGCCCCAACATTGTGGCTGTCACGAAACCAATATGGGCGTCCTTCGACATCAAGTTTGCGTGTCCACTCCTTGCGTCTCTGTGCCCGTACACGGC
GGCGAGTGGCTTGCTTCGAGGATATCGAAAGTGCAGTGGACGAGGTCGTCTGCGTTCCCGTATGTCGCTTGAAAGTCGACAACATTCTCGTCAACCTTCT
CCTCTCGCCCTTGTTGCGCGACGGCGAGCGGCACGAGAAAGGTGCCTTCTCCACAATCGGCTCGCCACAAAGCGTGCAAAAGCGGACACGCTTGAAGTTC
TCAAACGCACAGAAGTCGCACACGATGAACCCTTCCTCCGCATCTCTTCACACACAATATAGCGTCAGCTCTGCCAGCCTCCCTTTAATTGAACGGAGAC
AAACCTTAGTGCCGCATCCAGACGTCGATCATCGGAGCTGCACCCAACCAAATGGACAGCAGATAGCCGTTAGATACAGCAACCACACGCAGAATACCCG
GACGAAAGCAGATAGCCTCTAGCCTCCGTTATGGTCAACTGCATGTGCACGTACTCGATGAGTGGCGTATTCAGCTCCACCTCGCGCTCGAACTTCTTGA
ACGAACGTCGTGCCAGCCACGCGAAGAAGAGTGCGAAGAGCAGGGCGATCCCACACGCCACACCGATGGTCACGCCCACAGACATCACTCGGTGGCGTCC
TTGAGAAGGGCGAGAAGTTGGAGAGTGTCA