Description :
From Genome Similarity Track
Location :
Scaffold_1998:1395- 2466
Transcript NameFunction/comments
Phyra_87447Hypothetical protein

Sequence
1071 bases(100 bases per row)
ATTGGCAAACTCCATCAGCACGGCAAACATGCCAAAGGACATGAAGCATGGACTGGCCGCCCGCACATGTGCCTTGGACGTATACAACGACGGACGCGAC
TGGGTCCTCGTCGCTGACCACAATGGCATTCCTGCCACAACTGCCCGCGACATCGTCCAGCATGGGGCAACCGGCATCCAGAAGAGATGTGGCGCTCGGG
AGGCGTGCACGAAGTGCACGGCGGAGATGGAGGTAGCGCTGGCGGGCTACATCGAAGAAAACTACCAGTATACTCTCCCCCAGATGGTTGAGATGCTTCA
CTATAACTACGGGGTGCGCGGTAGCACCTCGTTAGTTAGTAAAAAAAAAAGCTGTGTGATAAGCTTTATTCGATGAAGCAAGTAATATTGAGCTAATATC
GTACAATGTTATTATGGATATGCTAACTATGTACATGTATCTGTGGTAATTACTGCAGGTTCGTGCTGAACAGGAAACGAACAACAATGCACAGAACCTT
GAAAAGCGGCGGGTTTCGGGGAGGCGCTGCTGAANTACAGAAGAAGGGCGCCTTTATCGTGTTCTATGACGAGACAAACTACAATTTGTATTGTAAACGC
ACGCAGGGCCGCACACCGATTGGCCTGCGGGCGGTTGTGAGGCTACCGCTCTGGAAGGGGGCTAACCTGTAACTACAATGCGCCGTCTCAGCTGAGATTG
GCTTGGTGCACTACGCGACGCAACGCGACAGCATCGAGATGGAGATTAACGCCGCGTTTATGGACGCGGTGTACGACGCGGTCAAGGACAACGAAGTGTT
TCGCGCCAACTTTGTCGGTAAGGGCATCGTCATTGTGCTGGACAATGCCCCTGCTCATAGTCAGACGGAGGGGCTTGTCCAATCCCGGGCAGACCTGAAG
CTGCTATGGTTGGGCCCGTTCTCGCCCATGTAGAGGGTGAGTACAAAGCTAACATGGCTACATGTAAGAACTGACTTTCGTGCTTGTTGTGCAGGTTATT
TTAGTTGTTTTTAGGGCCCGCATTAAGGTATTCCTTGCGCTGAGGTACGACGAGATGTTCAACGCGCCGCA